To analyse:
The structure of the molecule by postulating a model, which is consistent with the given observations.
Given:
The discovery of a primitive eukaryote with a unique
(a) X-ray diffraction studies show a general pattern resembling DNA (deoxyribonucleic acid), but has somewhat different dimensions and is more irregular.
(b) On heating and monitoring the UV (ultraviolet) absorption at 260 nm (nanometer), a major hypochromic shift is observed.
(c) Base-composition analysis shows four bases with proportions given below:
(1) Adenine is 8%
(2) Hypoxanthine is 18%
(3) Guanine is 37%
(4) Xanthine is 37%
(d) About 25 percent of the sugars are ribose and 75 percent are deoxyribose.
Introduction:
Watson and Crick proposed the double-stranded structure of DNA using X-ray diffraction. Four nitrogenous bases were discovered in DNA, out of which two were purines and two were pyrimidines. Purines are guanine and adenine while pyrimidines are thymine and cytosine in DNA. In RNA (ribonucleic acid), uracil is present instead of thymine. Hyperchromicity is the increase in the absorption of UV light by any
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Essentials of Genetics (9th Edition) - Standalone book
- The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in µm?arrow_forwardOn the planet Rama, the DNA is of six nucleotide types: A, B, C, D, E, and F. Types A and B are called marzines, C and D are orsines, and E and F are pirines. The following rules are valid in all Raman DNAs: Total marzines = total orsines = total pirines A = C = E B = D = Fa. Prepare a model for the structure of Raman DNA. b. On Rama, mitosis produces three daughter cells. Bearing this fact in mind, propose a replication pattern for your DNA model. c. Consider the process of meiosis on Rama. What comments or conclusions can you suggest?arrow_forwardEach group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of one strand of the oligomer is: 5’-AATGGTACGTATACTTTAT-3’ - show a table of % denaturation of DNA at different temperatures, using the equation provided in “Calculation” - plot a graph of % denaturation of DNA vs different temperatures with clear label and title, and hence determine the experimental Tm of the DNA sample - calculate the theoretical Tm of the sample using Marmur and Doty equation, compare the experimental Tm with theoretical Tm of the DNA samplearrow_forward
- 1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate the bases and backbone as lines. Label the major and minor grooves. 2) Sketch a ribose in the pucker that is expected in RNA. 3) Sketch a 2’ deoxyribose in the pucker that is expected in DNA. 4) Draw a GCG triplet (GC Watson-Crick), with perfect geometry. Draw the bases only, with dR’s at the N-9 positions of the purines (Gs) and at the N1 positions of the pyrimidine (C)arrow_forwardQ1) a) Draw the absorbance spectra for the following DNA samples. a. Pure DNA without protein contamination DNA with protein contamination b. c. DNA with organic solvent contamination b) An aqueous sample of genomic DNA gave an optical density of 0.6 AU. The sample was diluted 1:50 to achieve an OD below 1.0. The measurement was done in a cuvette with a pathlength of 1 cm. What was the concentration of DNA in the original sample BEFORE dilution? എന്ന് എന്നി per a WANANG KASAMA NA www in de for at de er der er en Iarrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forward
- Write the complementary sequence for the following DNA sequence, in order from 3' to 5': 5′−CGATATTGAGCTAAGCTT−3′arrow_forwardCalculate the approximate number of: Base pairs in 6 helical turns of B - DNA (based on the values from early X-ray diffraction structures ). Calculate the vertical length of the 6 helical turns in the B-form of DNA.arrow_forwardName and discuss using a representative example, the non-covalent interactions that maintains stability of the double helical structure of DNA.arrow_forward
- a) Explain the effect of the guanine:cytosine ratio on melting temperature of DNA. b) The Hershey-Chase experiment proved that DNA is the genetic material and not protein. Explain in detatil how this experiment was conducted.arrow_forwardGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forwardGiven the findings of biochemist Erwin Chargaff about the composition of DNA. Answer the following questions: (1) What is your general observation on their findings? (2) Why are the proportions of the nitrogen bases of human thymus and human sperm almost the same?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education