Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 29P
The DNA sequence below gives the first
Write the polarity of the two DNA strands shown.
Give the mRNA transcript sequence and the polarity of the transcript.
Assuming the sequence shown is part of a bacterial gene. Draw the approximate positions of the promoter sequence and the termination sequence.
Assuming the sequence shown is part of a bacterial gene, what consensus sequence (s) would you expect to identify in the promoter?
Write the anticipated bacterial consensus sequence(s) in the approximate position(s) on the diagram.
Assuming the sequence shown is part of a eukaryotic gene, what consensus sequence(s) would you expect to identify within about
Write the anticipated eukaryotic consensus sequence(s) in the approximate position(s) on the diagram.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart on the next page to answer the following questions.
Partial gene sequence of DNA nucleotides:
A C C T T A A T G A A C T C T
42. What is the mRNA nucleotide sequence that would result from transcription of the partial gene sequence of DNA nucleotides?
43. What is the protein amino acid sequence resulting from translation of the mRNA sequence from the previous question?
44. In the gene sequence of DNA nucleotides, guanine (G) is mistakenly replaced by adenine (A) during DNA replication.
What type of mutation would this be considered based on how it occurred? ________
a) spontaneous b) gametic c) mutagenic d) carcinogenic
45. Consider the mutation from the previous question. If it occurred within a skin cell of the body, what type of mutation would this also be considered based on where it occurred? ________
a) gametic b) germline c) heritable d) somatic
Use the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.
Use the mRNA coding chart above to answer these questions.
he following is the base sequence on a portion of a template strand of DNA.
3 ‘ TACGCCAGTGGTTCGCAC 5
Give the base sequence of the complementary DNA strand.
Give the base sequence of the strand of mRNA read from the original DNA template strand.
List, in order, the amino acids that would be present in this protein?
What would be the code that the methionine tRNA anticodon would carry?
Suppose a mutation altered the original DNA strand so that the 6th nucleotide was changed to a T.
i) How would this change the protein?
ii) What type of mutation is this?
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value. Please keep answer between 2-3 sentencesarrow_forwardRefer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .arrow_forwardUse this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA - 5' 5' - ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 2 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! #♡ 3 4 % 5 here ↓ < 6…arrow_forward
- Use the first picture and codon table to answer the following questions.arrow_forwardPlease please answer that full answer please What makes it possible to correctly start translation from an mRNA having multiple codons for methionine? Describe in context of eukaryotes and prokaryotes.arrow_forwardUse the gel diagram below to answer Questions 62 and 63. The positively-charged electrode of the electrophoresis gel is shown at the bottom of the diagram; the negatively-charged electrode is at the top. The mixture in each well included the original DNA fragment, all four dNTPs, one type of ddNTP as labeled in the diagram, and other necessary components of the dideoxy chain-termination reaction. The results are below. ddATP ddGTP ddCTP ddTTP (A) (B) (C) (D) (E) +. 62. Which of the following represents the sequence of the template strand?" A. 5'--GAAGACTAACATTCA--3' B. 5'-- ACTTACAATGTAGUA--3' C. 5'-- CTTCTGATTGTAAGT--3' D. 5'--ACTTACAATCAGAAG--3' E. 5'--TGAATGTTAGTCTTC--3'arrow_forward
- Complete the following table with the proper terms: Process Molecule made name of monomer Name of template that provides information Direction in which template is read Name of enzyme responsible for synthesis Replication Transcription translationarrow_forwardWhat is the survival value of the degeneracy of the genetic code? – Define what degeneracy means and then comment on why it would have survival value.arrow_forwardSelect the antisense strand of the DNA (opening at 3’ end from the left) and have it transcribed (RNA codons for translation). Translate the RNA codons using the given genetic code.arrow_forward
- The sequence below is DNA from an unknown cell. Use what you know about transcription to infer some things about the cell it came from and the RNA product it will form. Be sure to explain your answer for each question. 5’ – AGATTCAGGTCGAACATTATAGTCCAACTATACGGCGTTATGTCAATCCGCA – 3’ 3’ – TCTAAGTCCAGCTTGTAATATCAGGTTGATATGCCGCAATACAGTTAGGCGT – 5’ Which direction is upstream (left or right)? Possible Answers: A. Right - the promoter lies downstream of the transcription start site B. Left - the promoter lies upstream of the transcription start site C. Right - the promoter lies upstream of the transcription start site D. Left - the promoter lies downstream of the transcription start sitearrow_forwardGive typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′arrow_forwardWhat is the sequence in the template DNA strand during RNA production that encodes the codon GCU? Answer with 5’ and 3’ ends labeled.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY