Concept explainers
Wild-type E. coli grow best at
a.
b.
c.
d. What term best characterizes the type of mutation exhibited by the mutant bacterial strain? (Hint: The term was used in Chapter
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Different sensitivities to the mushroom toxin a-amanitin distinguish the three RNA polymerases from one another. Which of the following properties listed below also distinguish RNA Polymerase II from Pol I and Pol III? Options: Only RNA Pol II possesses a large subunit RNA Polymerase I and RNA Polymerase III do not require TBP for optimal transcription efficiency only RNA Polymerase II requires an ATP-dependent helicase to melt the DNA around the transcription start site Only RNA Polymerase II resembles the prokaryotic RNA Polymerase RNA Pol II has an extended N terminal region that becomes phosphorylated during intiationarrow_forwardIn bacteria's transcription and translation, not all RNAS and proteins are produced at the same time and quantities. Access the condition of prokaryotic transcription below with suitable control methods. When E. coli is exposed to heat shock or grown at higher temperaturearrow_forwardEF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in prokaryotic translation. The sigma subunit of RNA polymerase is replaced by NusA to recognise the promoter region of a gene. The -10 and -35 sequences in E. coli DNA are referred to as untranslated region. In human, translation begins before transcription of an mRNA completes. this statement true or false.arrow_forward
- The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. The new lac strain of Escherichia coli are as shown below: P+O+Z+Y+A+// P+O+Z+Y+A¯ (i) Illustrate how lactose induces the gene expression in lac 1 $// I-. (ii) Explain the function of the lacP and laco in the bacterial operon.arrow_forwardThe lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I ³ gene affects gene expression.arrow_forwardThe 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E. coli. Even so, the riboswitch in B. subtilis regulates transcription, whereas the one in E. coli regulates translation. What is the role of the 5′ region in both riboswitches? How can one riboswitch regulate transcription while the other regulates translation?arrow_forward
- A particular mutation in the bacterial sigma factor allows this protein to bind RNA polymerase but prevents it from coming off (detaching) RNA polymerase once it binds. What specific effect will this mutation have on transcription? It will prevent the transcription termination exerted by the Rho protein. It will prevent the formation of closed complexes between RNA polymerase and the promoter. It will prevent the formation of open complexes between RNA polymerase and the promoter. It will prevent the transition from the transcription initiation to the transcription elongation stage. It will prevent the synthesis of abortive RNA transcripts while the RNA polymerase is bound at the promoter.arrow_forwardConsider a mutant of E. coli that has an inactivating mutation in the gene for the catabolite activator protein (cap). Choose the compound(s) that could be provided to the mutant to achieve full transcription of the lac operon. If no combination of compounds can allow for transcription, chose none. ATP CAMP O glucose lactose nonearrow_forwardConsider a mutant of E. coli that has an inactivating mutation in the gene for adenylate cyclase (cya). Choose the compound(s) that could be provided to the mutant to achieve full transcription of the lac operon. If no combination of compounds can allow for transcription, chose none. O ATP O CAMP O glucose O lactose nonearrow_forward
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forwardThe DNA sequence of the promoter region of E. coli xyzA gene is shown below. Transcription start site is the A (in bold) at position 43. 5 10 15 20 25 30 35 40 45 50 GAGCT GTTGA CAATT AATCA TCGAA CTAGT TAACT AGTAC GCAAG TTCAC Mutations were introduced in the sequence to identify residues important for gene expression. Indicate the effect of the following mutations on xyzA expression (increase, decrease, no effect, cannot be predicted). Provide reasoning for each answer. A. G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double mutant T35G G45C C48A B. What are the promoter sequences of the gene?arrow_forwardTo characterize the promoter of the gadA operon you made a series of deletion mutants removing pieces of the promoter to see what would happen. The results are found below: gad promoter gada gadX gadz 450 +1 lacz activity transcription start site pH 2.0 pH 7.0 A gad promoter beta-galactosidase (lacZ) +++ 450 gad promoter beta galactosidase (lacZ) +++ +++ 300 +1 gad promoter beta galactosidase (lacZ) 150 D gad beta galactosidase (lacz) -450 150 E gad promoter beta-galactosidase (lacZ) -450 -300 Based on these results, what can you conclude about the gad promoter? O a. The promoter is only regulated by repression Ob. The promoter is regulated by a mix of activation and repression O c. The promoter is only regulated by activation O d. The promoter has multiple operators and multiple enhancersarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education