Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 7P
The DNA sequences shown below are from the promoter regions of six bacterial genes. In each case, the last
a. Examine these sequences and identify the Pribnow box sequence at approximately
b. Determine the consensus sequence for the Pribnow box from these sequences
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp,whereas the introns are 2.3 kb and 4.6 kb.a. Draw this gene, showing the promoter, introns, exons,and transcription start and stop sites.b. Surprisingly, this gene is found to encode not onebut two mRNAs that have only 224 nucleotides incommon. The original mRNA is 1204 nucleotides, andthe new mRNA is 2524 nucleotides. Use your drawing
Shown below is a schematic diagram illustrating a very short gene with 5000 bp region of an
unknown Schizosaccharomyces pombe genome. (Note: Transcription starts at Transcription
Start Site (TSS).)
TSS
5.
3'
3
+1
(i)
Name the specific regions that can be recognized by Transcription Factor IID (TF ID)
and indicate the locations in the diagram above.
(ii)
List the mechanistic steps that can trigger the initiation of transcription by Transcription
Factor IIH (TF IIH).
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp, whereas the introns are 2.3 kb and 4.6 kb.a. Draw this gene, showing the promoter, introns, exons, and transcription start and stop sites.b. Surprisingly, this gene is found to encode not one but two mRNAs that have only 224 nucleotides in common. The original mRNA is 1204 nucleotides, and the new mRNA is 2524 nucleotides. Use your drawingarrow_forwardConsider a gene being transcribed at a constant rate k1 and being degraded with first order kinetics with a rate constant of k2. a. Write the chemical reaction for transcriptionb. Derive the instantaneous concentration of the mRNA within the cell. Explicitly list all assumptions.arrow_forwardComparing the -10 regions of two E. coli promoters which have identical -35 regions revealed the sequence TATAAT for the first and GATACT for the second one. Why does the first promoter cause a higher transcription rate than the second one? a. The transcription rate from the first promoter will be higher, because RNA polymerase will bind TATAAT with a higher affinity than GATACT. b. It will be higher, because formation of the open promoter complex is more easily achieved with TATAAT than with GATACT. c. It will be higher, because TATAAT of the -10 region is transcribed into UAUAAU, which forms fewer hydrogen bonds with the template strand than GAUACU. d. a and b, but not c e. a, b, and carrow_forward
- A particular transposable element generates flanking direct repeats that are 4 bp long. Give the sequence that will be found on both sides of the transposable element if this transposable element inserts at the position indicated on each of the following sequences. a. Transposable element, a. 5'-ATTCGAACTGACCGATCA-3' b. b. Transposable element 5'-ATTCGAACTGACCGATCA-3'arrow_forwardThe hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forward
- The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?arrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold). a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)arrow_forwardWrite a hypothetical sequence of bases that might be found in the first 20 nucleotides of a promoter of a bacterial gene. Include both strands of DNA and identify the 5′ and 3′ ends of both strands. Be sure to include the transcription start site and any consensus sequences found in the promoter.arrow_forward
- Suppose you have a 1-kb segment of cloned DNA that is suspected to contain a eukaryotic promoter including a TATA box, a CAT box, and an upstream GC-rich sequence. The clone also contains a gene whose transcript is readily detectable. Your laboratory supervisor asks you to outline an experiment. (1) determine if eukaryotic transcription factors (TF) bind to the fragment and, if so, (2) identify where on the fragment the transcription factors bind. All necessary reagents, equipment, and experimental know-how are available in the laboratory. Complete the outline of an experiment, which determines if eukaryotic transcription factors (TF) bind to the fragment. Assume all necessary reagents, equipment, and experimental how are available in the laboratory. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Not all terms will be used. For the band shift assay, two samples of the DNA fragment are analyzed by agarose gel electrophoresis: one sample is…arrow_forwardThe following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!arrow_forwardExons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license