Complete the following table with the proper terms: Process Molecule made name of monomer Name of template that provides information Direction in which template is read Name of enzyme responsible for synthesis Replication           Transcription           translation

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Complete the following chart. Region Length Multiples of 3?

A: RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with…

Q: DNA G C A strand DNA TA C TA C strand MRNA A U G U G codon TRNA anticod G on Amino Tryptoph Stop…

A: DNA is deoxyribonucleic acid which acts as a source of genetic material inside living organisms. DNA…

Q: Use the terms provided to label the diagram of transcription. transcription RNA $41 DNA DNA coding…

A: Transcription:Transcription is the synthesis of mRNA in the 5' -> 3' direction from the template…

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: Complete the table. For the polypeptide, use the three-letter code. Note: Reference the Genetic code…

A: Genetic code table basis:Reference:…

Q: Write if TRUE/FALSE. mRNA splicing takes place in bacteria. In eukaryotes, replication and…

A: FALSE. Explanation:mRNA splicing does not take place in bacteria. mRNA splicing is a process that…

Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…

A: Replication, transcription, translation are the three processes of central dogma of life.…

Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…

A: The ribosome is a special organelle in the cell that is responsible for protein production. The…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…

A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens…

A: The Central Dogma of life involves three steps: DNA ==> DNA ==> RNA ==> Proteins The…

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Which of the following is the prokaryotic helicase?     DnaB   DnaD   DnaA   DnaC

A: Helicases are enzymes that help double stranded DNA helixes unwind during DNA replication,…

Q: 3 ‘  TACGCCAGTGGTTCGCAC  5   Give the base sequence of the complementary DNA strand.  Give…

A: Base sequence of template strand this 3 ‘  TACGCCAGTGGTTCGCAC  5 is  5' ATGCGGTCACCAAGCGTG 3'   mRNA…

Q: g12 DNA T C G A T mRNA tRNA

A: * DNA also called as deoxy ribonucleic acid . * DNA is made up of four types of  nucleotides.They…

Q: On the image showing the transcription of DNA to RNA, what does the letter F represent? Select the…

A:

Q: A fragment of DNA that was cut with a restriction enzyme has a 3’ overhang. This overhang is…

A: Restriction Enzymes: These enzymes identify certain DNA sequences, known as recognition or…

Q: library contains a collection of DNA clones derived from MRNAS. library contains a collection of DNA…

A: Genomic library is a library which encompasses the entire genome.  Genomic Library involves the…

Q: REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens…

A: DNA replication is the biological process of producing two identical copies of DNA from one original…

Q: Which musical instrument does the replication process resemble? O tuba O trumpet trombone

A: Replication is an important process that takes place in all organisms that ensure the maintenance of…

Q: Fill in the blanks in the paragraph about DNA replication. DNA replication begins at the…

A: Central Dogma concept revolves around the three processes of Replication, Transcription and…

Q: The phrases or terms below describe different fundamental processes of nucleic acids. Sort each…

A: The process of protein synthesis involves three main stages: replication, transcription, and…

Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…

A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…

Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: Base oxidation (small damage to a single nucleotide) is repaired using:

A: Introduction:DNA damage can occur due to various factors, including exposure to reactive oxygen…

Q: Draw replication forks that show what you would expect to see if a cell were unable to make the…

A: Replication is the process of synthesis of new DNA strand from the existing ones. The existing DNA…

Q: The origin is the site on the DNA: is ONLY where transcription begins is ONLY where translation…

A: Origin is the site seen on the DNA sequence which initiates the process of replication. This is…

Q: Below is a list of functions related to protein synthesis. Place the number for the function in the…

A: The process of  copying information from the DNA molecules into the molecule of RNA is called…

Q: Below is a picture of a single origin of replication in a eukaryotic cell.

A: Deoxyribonucleic acid (DNA) is the hereditary material that undergoes replication which is vital for…

Q: complete the table by describing the consequences of the following defects.   Defect  HIGHLIGHT…

A: DNA replication is the process by which a copy of a DNA strand is produced. DNA replication usually…

Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…

A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: ist each enzyme used in replication. Designate between bacteria enzymes and non-bacteria.

A: The process of synthesis of a new DNA strand from the template DNA strand by the action of enzyme…

Q: Which process is illustrated in the diagram? Replication Transcription RNA processing Translation…

A: DNA (deoxyribonucleic acid) is a molecule that carries genetic information in living organisms. It…

Q: Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to…

A: Replication : it is the process where DNA duplicates Transcription: the process of making an RNA…

Q: Name (Last, First): DNA An RNA Polymerase attaches to the DNA and transcribes the DNA to mRNA…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: The enzyme that separates the two strands of a DNA molecule during replication is:   DNA ligase

A: 1. The enzyme that separates the two strands of a DNA molecule during replication is helicase. The…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Transcribe the following DNA strand into a RNA strand. CAA a BFF GUU CAA GTT

A: DNA strands change into mRNA by transcription.

Q: Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on…

A: Genes are the structural and functional units of heredity that carry coded genetic information in…

Q: e correct order of the Phases of replication

A:

Q: Classify each description as a property of DNA only, RNA only, or both DNA and RNA. DNA only RNA…

A: DNA is the genetic material which resides in nucleus. So, they are passed from existing cells to new…

Q: Circle the section on the DNA template where the example primer would bind.

A: A primer binds to a specific region of a single-stranded DNA template, known as the primer binding…