Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) here 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA-5' 5'-ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! Next

Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or protein processing events in your answers. transcription terminates promoter (transcription initiates here) here 3'-TACATGGAGGGTCGTACTAATTATGGATCTAGTTATCATGTA-5' 5'-ATGTACCTCCCAGCATGATTAATACCTAGATCAATAGTACAT-3' 1. The type your answer... I strand will be used as the template for transcription. (enter only top or bottom; any deviation from this answers will receive no credit. The sequence of the RNA encoded by the gene is type your answer... Type in only the nucleotide sequence of the RNA in the 5' to 3' direction (do not label the ends or add any punctuation marks or spaces). The sequence of the protein encoded by the gene is type your answer... Type the protein sequence using the single-letter amino acid abbreviations from its N to C terminus. Do not label the ends or add any spaces or punctuation marks! Next

Name: Use this diagram of a eukaryotic gene to answer the following questio
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the requested format of your answers. Do not consider any RNA or proteinprocessing events in your answers.transcription terminatespromoter(transcription

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 7SQ

See similar textbooks

Similar questions

For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
Kindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCG
You may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3
Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Event Tryptophan high Tryptophan low Ribosome does not stall at Trp codons ____________ ____________ Region 2 of the leader pairs with region 3 ____________ ____________ Ribosome covers part of region 2 of leader ____________ ____________ Transcription is terminated before structural genes are transcribed ____________ ____________
Match the correct answer to each blank. Note that each answer (1 through 4) can be used more than once Eukaryotic mRNAs Prokaryotic mRNAs Transfer RNAs Ribosomal RNAs 1. They contain exons and introns _____ 2. They are the template of genetic informtaion during protein synthesis ______ 3. They contain unusual or modified nitrogenous bases ______ 4. They display an anticodon each ______ 5. They have a cloverleaf structure ______ 6. They are synthesized by RNA polymerases ______ 7. They get charged with an amino acid by aminoacyl-tRNA synthetase ______ 8. They are capped on their 5' ends and polyadenylated on their 3' ends 9. There are 4 types of these in eukaryotes and only 3 types in E. coli ______
The assembly of transcription factors on a promoter begins some 25 nucleotides upstream where it binds to a start _______________ sequence Group of answer choices TAAT ATTA TATA ATGC
Use the genetic code to answer these questions. Second letter U A G UCU) UCC UGU) Cys UAU Tyr UGccys UGC. UUU U Phe UAC UUC U UUA Ser }Le UCA UAA Stop UGA Stop | A Leu UUG. UCG UAG Stop UGG Trp G CCU ССС CAU1 CGU CGC Arg CUU CÁCHIS Pro CUC Leu CUA ССА САА CGA CCG CAG Gln CUG CGG AAU Asn AGU AUU ACU Ser AUC ile A AUA А ACA AAC J Thr AAA Lys AGC JArg AGA AUG Met | ACG AAGJ AGG. GCU GUU) GUC G GUA GAU Asp GACJ GGU) GGC Gly GCC - Val Ala GCA GAA GGA GCG Glu GAGS GGG GUG G Q3.1 Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding to the coding strand (the one that would be made by RNA polymerase reading the template strand). Label the 5' and 3' termini. Coding strand 5'- ТАTGAAATTТAAATTT - 3' Template strand 3'— АТАСТТТАААТTТАAA - 5' Enter your answer here First letter DUAG Third letter DUAG
Use the codon chart to translate the following MRNA transcript into a protein. Please format your answer in this way .....*. Seond letter UUU UUC UCU UCC UCA UAU UAC U Cys Phe UGU UGC UAA Stop UGA Stop A UAG Stop UGG TrpG Tyr C Ser UUA Leu UUG UCG CUU CCU CGU CGC CAU His CUC CAC C. CỦA CUG Leu Pro Arg CCA CGA CAA CAG Gin CGG AAU AGU AGC AUU ACU Asn Ser AUC lle ACC AAC Thr AUA AUG Met ACG ACA AAA AGA A. Arg AAG Lys AGG GCU GCC GCA GUU GAU GGU GGC Asp GUC Val GUA GAC GAA GAG Ala Gly GGA GGG Glu GUG GCG AUGCCUGGACAUUUUCAAGUAUAA HTML Editor BIUA - A - I E Z I 1 I x x, E E Paragraph First letter Third letter
Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and write the mature mRNA sequence. Then write the amino acid sequence of the resulting transcript. AGAGCTACCAGCTTTAGCGGGATATAAACACACTTATCCTACTATCCCTA 51 TCTTCCCCCAAAGAGGGATCATGCCGTCGACGGCCAAACCGATCGAGCGG 101 AGGTTAAGGGCCATTGGAAAAGGACACTCTGTACGACTAAGAAAATAGC 151 AGCGACTGAGCTGAACGCTACGGGGGGGGGGGTATATACCCCCCCCCCCC 201 CCAGCTACGAGCGACTTTTTATTTTTTTTTTTTATTTTTTTTCTTTTTTA 251 TTTTTTTTGTTTTTTTTTTTCGCGACTACAGAGACTTCTAGCGATCGACG 301 AGCTAGCTAGCGCGGCATCGGACGCGATCGCGATCCTAGACTCTACGAT
This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
This question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else, so that Moodle can grade your question correctly.