The complete sequence of a gene is present in a 2-kb fragment of E.coli DNA. Transcription of this gene is terminated by the rho protein. The complete promoter sequence as well as the terminator region of the gene is present in this fragment. Band shift assay examined the cloned fragments. Here each lane of a single electrophoresis gel contains the 2-kb cloned fragment under the following conditions: Lane 1: 2-kb fragment only. Lane 2: 2-kb fragment plus the core enzyme Lane 3: 2-kb fragment plus the RNA polymerase holoenzyme Lane 4: 2-kb fragment plus rho protein a. Sketch the relative positions expected for the DNA fragments in this gel electrophoresis analysis. b. Identify the relative positions of bands in lane 1 & 3 . c. The relative positions of bands in lanes 1 & 4 are to be explained. Introduction: Band shift assay is a technique to study the interactions between protein and DNA. The assay is based on non-denaturing gel electrophoresis that runs complexes of proteins and DNA through it. The migration of either DNA or RNA is compared to the migration of a complex of particular protein with DNA or RNA. This study helps to reveal the degree and nature of binding between them. It is also termed as electrophoretic mobility shift assay. The Band shift assay is the separation technique for proteins, DNA and RNA, the mixture of interest is loaded onto an agarose gel and observed for speed, size, and shape.

Question

Want to see the full answer?

Answer 1

Question

Chapter 8, Problem 17P

Summary Introduction

To analyze:

The complete sequence of a gene is present in a 2-kb fragment of E.coli DNA. Transcription of this gene is terminated by the rho protein. The complete promoter sequence as well as the terminator region of the gene is present in this fragment. Band shift assay examined the cloned fragments. Here each lane of a single electrophoresis gel contains the 2-kb cloned fragment under the following conditions:

Lane 1: 2-kb fragment only.

Lane 2: 2-kb fragment plus the core enzyme

Lane 3: 2-kb fragment plus the RNA polymerase holoenzyme

Lane 4: 2-kb fragment plus rho protein

a. Sketch the relative positions expected for the DNA fragments in this gel electrophoresis analysis.

b. Identify the relative positions of bands in lane 1 & 3.

c. The relative positions of bands in lanes 1 & 4 are to be explained.

Introduction:

Band shift assay is a technique to study the interactions between protein and DNA. The assay is based on non-denaturing gel electrophoresis that runs complexes of proteins and DNA through it. The migration of either DNA or RNA is compared to the migration of a complex of particular protein with DNA or RNA. This study helps to reveal the degree and nature of binding between them. It is also termed as electrophoretic mobility shift assay. The Band shift assay is the separation technique for proteins, DNA and RNA, the mixture of interest is loaded onto an agarose gel and observed for speed, size, and shape.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation. a) List all the steps from cell pellet preparation to DNA elution. b) With which feature can the membrane in the column that comes with the commercial kit bind DNA? c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?

Choose 1 or more than 1 RNA are extracted from liver cells and separated in agarose gel by electrophoresis side-by-side with a molecular weight marker. The separated RNA fragments are then transferred to an RNA-binding membrane. Next, this membrane is incubated with labelled probe specific for the gene X. This experiment determines: how many copies of gene X there are in liver cells. if the gene X is translated in liver cells. if gene X has a point mutation in liver cells. the chromosomal location of gene X. the length of the transcript of gene X.

Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…