Concept explainers
A study was conducted in an attempt to determine which functional regions of a particular conjugative transfer gene (tral) are involved in the transfer of plasmid R27 in Salmonella enterica. The R27 plasmid is of significant clinical interest because it is capable of encoding multiple-antibiotic resistance to typhoid fever. To identify functional regions responsible for conjugal transfer, an analysis by Lawley et al. [(2002). J. Bacteriol. 184:2173-2180] was conducted in which particular regions of the tral gene were mutated and tested for their impact on conjugation. Shown here is a map of the regions tested and believed to be involved in conjugative transfer of the plasmid. Similar coloring indicates related function. Numbers correspond to each functional region subjected to mutation analysis.
Accompanying the map is a table showing the effects of these mutations on R27 conjugation.
Effects of Mutations in Functional Regions of Transfer Region 1 (tral) on R27 Conjugation
- (a) Given the data, do all functional regions appear to influence conjugative transfer?
- (b) Which regions appear to have the most impact on conjugation?
- (c) Which regions appear to have a limited impact on conjugation?
- (d) What general conclusions might one draw from these data?
Want to see the full answer?
Check out a sample textbook solutionChapter 6 Solutions
Concepts of Genetics (12th Edition)
- The transfection reagent used to introduce plasmids to the HEK293 cells was a lipid reagent. Why is lipid utilized for this procedure?arrow_forwardA microbial geneticist isolates a new mutation in E. coliand wishes to map its chromosomal location. She usesinterrupted-mating experiments with Hfr strains andgeneralized-transduction experiments with phage P1.Explain why each technique, by itself, is insufficient foraccurate mapping.arrow_forwardBy conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the following table:Explain how these results are consistent with the idea that thebacterial chromosome is circular?arrow_forward
- We have two specific strains of E. coli that have shown horizontal gene transfer (HGT) when mixed. To experimentally determine the method of HGT that is happening, the following conditions are set up in different tubes of culture media: A) Donor and recipient strain mixed together (control - no treatment). B) Donor and recipient strains mixed together, DNase added (can digest DNA in solution, not within cells).C) Special tube containing a membrane filter (with pores that allow DNA and viruses to pass through, but not bacterial cells) that separates two compartments. Donor strain is added on one side, the recipient strain on the other (they are separated by the filter).D) Donor and recipient strains mixed together, with chemical that inactivates viruses (chemical affects bacteriophages in solution so they are unable to attach to cells). The results: Tubes A, B, and D: HGT was observed. Tube C: HGT was NOT observed. Based on this, which type of HGT was occurring? Conjugation,…arrow_forwardThe Pfizer Covid-19 vaccine is one of the vaccines currently being rolled out for mass vaccination in South Africa to protect the population against SARS CoV-2, and the active compound in this vaccine is an mRNA molecule. a) The starting material for productio of this vaccine is a copy of the coronavirus spike protein gene cloned into a ppasmid. List the main experimental steps in the vaccine production process, to go from a plamid to an mRNA molecule. b) Which molecular processes in the cell will allow an injected strand of mRNA to produce anti-Covid immunity in the vaccine recipient?arrow_forwardBacteriophage P22 was used in generalised transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the recipient strains of S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the selected for one of the three genetic markers studied (str, aceA, thrA), and were made to select the recombinants corresponding to the other two markers. markers. The results are given in the following table: Strain I donor str thrA aceA thrA str aceA+ Strain recipient strs thrA+ aceA thrA str aceA Phenotype selected Str Ace+ Str recombinants selected ThrA ThrA ThrA ThrA Ace Ace Number 60 40 95 5 10 90 str: gene involved in streptomycin resistance, aceA: gene involved in the use of acetate as a carbon source, thrA: gene involved in threonine biosynthesis. 1) What are the selective media used in these three transduction experiments? to obtain the selected…arrow_forward
- Bacteriophage P22 was used in generalized transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the three genetic markers studied (str, aceA, thrA), and then replicates were performed to select the corresponding recombinants for the other two markers. The results are given in the following table: Recipient strain Selected phenotype Selected recombinants Donor strain str thrA aceA+ thrA str aceA+ strs thrA+ aceA thrA+ str aceA Str Ace+ Str ThrA ThrA+ ThrA ThrA+ Ace Ace str: gene involved in streptomycin resistance, aceA gene involved in the use of acetate as a carbon source, thrA: gene involved in the biosynthesis of threonine. Number 60 40 95 5 10 90 Determine the order of the genes and draw a genetic map showing this orderarrow_forwardMany resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardThe strain of λ phage t is cI857. That tells you that the cI DNA segment is disabled by a specific mutation. What is the exact genetic change in cI857? What specific property of the cI gene product does this mutation change, and how does this help titering for a plaque assay?arrow_forward
- In 1944, Avery, Macleod, and McCarty provided strong evidence that DNA is the hereditary material in Streptococcus pneumoniae by Group of answer choices showing that avirulent cells could become virulent by the process of transduction none of these is true. showing that virulent cells could become avirulent if the DNA was destroyed after transformation showing that avirulent cells could not gain the ability to become virulent cells if conjugation was interrupted. showing that avirulent cells could not gain the ability to become virulent if DNA was destroyed after transformation.arrow_forwarda. Bacteriophage P22 was used in generalized transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the three genetic markers studied (str, aceA, thrA), and then replicates were performed to select the corresponding recombinants for the other two markers. The results are given in the following table: Recipient strain Selected phenotype Selected recombinants Donor strain str thrA aceAt thrA str aceA+ strs thrA+ aceA thrA+ str aceA Str Ace+ Str ThrA ThrA+ ThrA ThrA+ Ace Ace+ str: gene involved in streptomycin resistance, aceA: gene involved in the use of acetate as a carbon source, thrA: gene involved in the biosynthesis of threonine. Number 60 40 95 5 10 90 What are the selective media used in these three transduction experiments, on the one hand to obtain the selected…arrow_forwardBy conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the following table:What information do you know based on the question and your understanding of the topic?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education