Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 29ESP
A study was conducted in an attempt to determine which functional regions of a particular conjugative transfer gene (tral) are involved in the transfer of plasmid R27 in Salmonella enterica. The R27 plasmid is of significant clinical interest because it is capable of encoding multiple-antibiotic resistance to typhoid fever. To identify functional regions responsible for conjugal transfer, an analysis by Lawley et al. [(2002). J. Bacteriol. 184:2173-2180] was conducted in which particular regions of the tral gene were mutated and tested for their impact on conjugation. Shown here is a map of the regions tested and believed to be involved in conjugative transfer of the plasmid. Similar coloring indicates related function. Numbers correspond to each functional region subjected to mutation analysis.
Accompanying the map is a table showing the effects of these mutations on R27 conjugation.
Effects of Mutations in Functional Regions of Transfer Region 1 (tral) on R27 Conjugation
- (a) Given the data, do all functional regions appear to influence conjugative transfer?
- (b) Which regions appear to have the most impact on conjugation?
- (c) Which regions appear to have a limited impact on conjugation?
- (d) What general conclusions might one draw from these data?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is meant by the term site-specific recombination as used in identifying the processes that lead to the integration of temperate bacteriophages into host bacterial chromosomes during lysogeny or to the formation of specialized transducing phage?
In a generalized-transduction experiment, phages arecollected from an E. coli donor strain of genotype cys+leu+ thr+ and used to transduce a recipient of genotypecys- leu- thr-. Initially, the treated recipient populationis plated on a minimal medium supplemented with leucine and threonine. Many colonies are obtained.a. What are the possible genotypes of these colonies?b. These colonies are then replica plated onto threedifferent media: (1) minimal plus threonine only, (2)minimal plus leucine only, and (3) minimal. Whatgenotypes could, in theory, grow on these three media?c. Of the original colonies, 56 percent are observed togrow on medium 1, 5 percent on medium 2, and nocolonies on medium 3. What are the actual genotypes ofthe colonies on media 1, 2, and 3?d. Draw a map showing the order of the three genes andwhich of the two outer genes is closer to the middle gene
A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphologyis strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?
Also, describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon and why is it more likely that insertions or deletions will be more detrimental to a cell than point mutations?
Chapter 6 Solutions
Concepts of Genetics (12th Edition)
Ch. 6 - When the interrupted mating technique was used...Ch. 6 - In a transformation experiment involving a...Ch. 6 - In complementation studies of the rII locus of...Ch. 6 - A 4-month-old infant had been running a moderate...Ch. 6 - Prob. 2CSCh. 6 - Prob. 3CSCh. 6 - Prob. 4CSCh. 6 - HOW DO WE KNOW? In this chapter, we have focused...Ch. 6 - Review the Chapter Concepts list on p. 123. Many...Ch. 6 - With respect to F+ and F bacterial matings, answer...
Ch. 6 - List all major differences between (a) the F+ F...Ch. 6 - Describe the basis for chromosome mapping in the...Ch. 6 - In general, when recombination experiments are...Ch. 6 - Why are the recombinants produced from an Hfr F...Ch. 6 - Describe the origin of F bacteria and merozygotes.Ch. 6 - In a transformation experiment, donor DNA was...Ch. 6 - Describe the role of heteroduplex formation during...Ch. 6 - Explain the observations that led Zinder and...Ch. 6 - Prob. 12PDQCh. 6 - Two theoretical genetic strains of a virus (abc...Ch. 6 - The bacteriophage genome consists of many genes...Ch. 6 - If a single bacteriophage infects one E. coli cell...Ch. 6 - A phage-infected bacterial culture was subjected...Ch. 6 - In recombination studies of the rII locus in phage...Ch. 6 - In an analysis of rII mutants, complementation...Ch. 6 - If further testing of the mutations in Problem 18...Ch. 6 - Using mutants 2 and 3 from Problem 19, following...Ch. 6 - During the analysis of seven rII mutations in...Ch. 6 - In studies of recombination between mutants 1 and...Ch. 6 - Prob. 23ESPCh. 6 - An Hfr strain is used to map three genes in an...Ch. 6 - A plaque assay is performed beginning with 1 mL of...Ch. 6 - In a cotransformation experiment, using various...Ch. 6 - For the experiment in Problem 26, another gene, g,...Ch. 6 - Bacterial conjugation, mediated mainly by...Ch. 6 - A study was conducted in an attempt to determine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The transfection reagent used to introduce plasmids to the HEK293 cells was a lipid reagent. Why is lipid utilized for this procedure?arrow_forwardA microbial geneticist isolates a new mutation in E. coliand wishes to map its chromosomal location. She usesinterrupted-mating experiments with Hfr strains andgeneralized-transduction experiments with phage P1.Explain why each technique, by itself, is insufficient foraccurate mapping.arrow_forwardBy conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the following table:Explain how these results are consistent with the idea that thebacterial chromosome is circular?arrow_forward
- We have two specific strains of E. coli that have shown horizontal gene transfer (HGT) when mixed. To experimentally determine the method of HGT that is happening, the following conditions are set up in different tubes of culture media: A) Donor and recipient strain mixed together (control - no treatment). B) Donor and recipient strains mixed together, DNase added (can digest DNA in solution, not within cells).C) Special tube containing a membrane filter (with pores that allow DNA and viruses to pass through, but not bacterial cells) that separates two compartments. Donor strain is added on one side, the recipient strain on the other (they are separated by the filter).D) Donor and recipient strains mixed together, with chemical that inactivates viruses (chemical affects bacteriophages in solution so they are unable to attach to cells). The results: Tubes A, B, and D: HGT was observed. Tube C: HGT was NOT observed. Based on this, which type of HGT was occurring? Conjugation,…arrow_forwardThe Pfizer Covid-19 vaccine is one of the vaccines currently being rolled out for mass vaccination in South Africa to protect the population against SARS CoV-2, and the active compound in this vaccine is an mRNA molecule. a) The starting material for productio of this vaccine is a copy of the coronavirus spike protein gene cloned into a ppasmid. List the main experimental steps in the vaccine production process, to go from a plamid to an mRNA molecule. b) Which molecular processes in the cell will allow an injected strand of mRNA to produce anti-Covid immunity in the vaccine recipient?arrow_forwardBacteriophage P22 was used in generalised transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the recipient strains of S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the selected for one of the three genetic markers studied (str, aceA, thrA), and were made to select the recombinants corresponding to the other two markers. markers. The results are given in the following table: Strain I donor str thrA aceA thrA str aceA+ Strain recipient strs thrA+ aceA thrA str aceA Phenotype selected Str Ace+ Str recombinants selected ThrA ThrA ThrA ThrA Ace Ace Number 60 40 95 5 10 90 str: gene involved in streptomycin resistance, aceA: gene involved in the use of acetate as a carbon source, thrA: gene involved in threonine biosynthesis. 1) What are the selective media used in these three transduction experiments? to obtain the selected…arrow_forward
- Bacteriophage P22 was used in generalized transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the three genetic markers studied (str, aceA, thrA), and then replicates were performed to select the corresponding recombinants for the other two markers. The results are given in the following table: Recipient strain Selected phenotype Selected recombinants Donor strain str thrA aceA+ thrA str aceA+ strs thrA+ aceA thrA+ str aceA Str Ace+ Str ThrA ThrA+ ThrA ThrA+ Ace Ace str: gene involved in streptomycin resistance, aceA gene involved in the use of acetate as a carbon source, thrA: gene involved in the biosynthesis of threonine. Number 60 40 95 5 10 90 Determine the order of the genes and draw a genetic map showing this orderarrow_forwardMany resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardThe strain of λ phage t is cI857. That tells you that the cI DNA segment is disabled by a specific mutation. What is the exact genetic change in cI857? What specific property of the cI gene product does this mutation change, and how does this help titering for a plaque assay?arrow_forward
- In 1944, Avery, Macleod, and McCarty provided strong evidence that DNA is the hereditary material in Streptococcus pneumoniae by Group of answer choices showing that avirulent cells could become virulent by the process of transduction none of these is true. showing that virulent cells could become avirulent if the DNA was destroyed after transformation showing that avirulent cells could not gain the ability to become virulent cells if conjugation was interrupted. showing that avirulent cells could not gain the ability to become virulent if DNA was destroyed after transformation.arrow_forwarda. Bacteriophage P22 was used in generalized transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the three genetic markers studied (str, aceA, thrA), and then replicates were performed to select the corresponding recombinants for the other two markers. The results are given in the following table: Recipient strain Selected phenotype Selected recombinants Donor strain str thrA aceAt thrA str aceA+ strs thrA+ aceA thrA+ str aceA Str Ace+ Str ThrA ThrA+ ThrA ThrA+ Ace Ace+ str: gene involved in streptomycin resistance, aceA: gene involved in the use of acetate as a carbon source, thrA: gene involved in the biosynthesis of threonine. Number 60 40 95 5 10 90 What are the selective media used in these three transduction experiments, on the one hand to obtain the selected…arrow_forwardBy conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the following table:What information do you know based on the question and your understanding of the topic?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license