Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 18PDQ
In an analysis of rII mutants, complementation testing yielded the following results:
Predict the results of testing 2 and 3, 2 and 4, and 3 and 4 together.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A fluctuation test was carried out to determine the rate of mutation to Azetidine resistance (a toxic
proline analog) in S. typhimurium. Twenty tubes of rich medium were each inoculated with a few
wild-type cells and the cultures were grown to 10° cells / ml. A 0.1 ml sample of each culture was
then plated on each plate (a total of 20 plates) to detect AztR mutants. The results are shown in the
following table. Calculate the mutation rate of S. typhimurium to AztR.
Culture #
# AztR mutants
Culture #
# AztR mutants
11
12
3
4.
13
14
15
4.
30
303
97
69
14
16
17
18
19
20
10
19
How do you interpret Weil-Felix Test?
What are the sources of errors of the Weil-Felix Test?
Below are 9 possible primer pairs.
● Determine which primer pair is the best choice by considering the following:
1. primers should be 18-24 bases in length;
2. base composition should be 45-55% (G+C);
3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and
increases efficiency of priming;
4. Tms tween 55-70°℃ are preferred (Tas, annealing temperatures, are approximately 5°C
lower than the Tm);
5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the
same;
6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or
C-rich sequences (because of stability of annealing), and should be avoided;
7.
3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation
of primer dimers will result;
8. primer self-complementary (ability to form secondary structures such as hairpins) should
be avoided.
• Explain why the other primers are not good choices.
● Underline or…
Chapter 6 Solutions
Concepts of Genetics (12th Edition)
Ch. 6 - When the interrupted mating technique was used...Ch. 6 - In a transformation experiment involving a...Ch. 6 - In complementation studies of the rII locus of...Ch. 6 - A 4-month-old infant had been running a moderate...Ch. 6 - Prob. 2CSCh. 6 - Prob. 3CSCh. 6 - Prob. 4CSCh. 6 - HOW DO WE KNOW? In this chapter, we have focused...Ch. 6 - Review the Chapter Concepts list on p. 123. Many...Ch. 6 - With respect to F+ and F bacterial matings, answer...
Ch. 6 - List all major differences between (a) the F+ F...Ch. 6 - Describe the basis for chromosome mapping in the...Ch. 6 - In general, when recombination experiments are...Ch. 6 - Why are the recombinants produced from an Hfr F...Ch. 6 - Describe the origin of F bacteria and merozygotes.Ch. 6 - In a transformation experiment, donor DNA was...Ch. 6 - Describe the role of heteroduplex formation during...Ch. 6 - Explain the observations that led Zinder and...Ch. 6 - Prob. 12PDQCh. 6 - Two theoretical genetic strains of a virus (abc...Ch. 6 - The bacteriophage genome consists of many genes...Ch. 6 - If a single bacteriophage infects one E. coli cell...Ch. 6 - A phage-infected bacterial culture was subjected...Ch. 6 - In recombination studies of the rII locus in phage...Ch. 6 - In an analysis of rII mutants, complementation...Ch. 6 - If further testing of the mutations in Problem 18...Ch. 6 - Using mutants 2 and 3 from Problem 19, following...Ch. 6 - During the analysis of seven rII mutations in...Ch. 6 - In studies of recombination between mutants 1 and...Ch. 6 - Prob. 23ESPCh. 6 - An Hfr strain is used to map three genes in an...Ch. 6 - A plaque assay is performed beginning with 1 mL of...Ch. 6 - In a cotransformation experiment, using various...Ch. 6 - For the experiment in Problem 26, another gene, g,...Ch. 6 - Bacterial conjugation, mediated mainly by...Ch. 6 - A study was conducted in an attempt to determine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain selectable and non selectable markers for the detection of transformants?arrow_forwardBelow is an EMSA showing four different reactions, A-D. In each tube there is some combination of labelled DNA probe, Protein X (the protein you are studying), and an antibody for Protein X. Identify which combination of components are found in each of the four reactions and explain how you determined that based on the molecular interactions being studied and your knowledge of gel electrophoresis. It is possible that multiple lanes have the same component(s). A B C D EMSAarrow_forwardAt higher amounts of protein, the Bradford assay is not linear. Consider the plot to the right: what is the maximum amount of protein a sample could contain and still fall within a standard curve? Briefly explain your reasoning.arrow_forward
- Below is a partially filled in complementation table. Please answer the following questions. 1 2 3 4 LO 5 6 1 2 I 3 4 5 4 + + 5 6 a. If you were to perform a complementation test with mutants 1 and 2, what would be the result? [Select] b. If you were to perform a complementation test with mutants 5 and 6, what would be the result? [Select] c. If you were to perform a complementation test with mutants 3 and 4, what would be the result? [Select] d. There is one complementation group that you can determine from the information above. If you performed a complementation test with mutant 1 and 6 and there was growth, would you say that the mutants were part of that complementation group? [Select] e. What is the minimum number of complementation groups that could exist based on the information above? [Select] f. What is the maximum number of complementation groups that could exist based on the information above? [Select]arrow_forwardIn a cotransduction experiment involving P1, the cotransductionfrequency was 0.53. How far apart are the two genes?arrow_forwardExplain the similarities and differences between the procedures used for the coarse-scale mapping and fine-scale mapping of QTLs through controlled crosses, as was accomplished for QTLs involved with tomato size.arrow_forward
- (a) Explain sensitivity and selectivity in terms of true and false positives. (b) What is the advantage of a Needleman-Wunsch alignment compared to a seeded alignment? (c) What does the expectation parameter mean in local alignment? What will happen if the expectation value is increased from its default value of 10 to a 100?arrow_forwardExplain the multiple testing problem of GWAS - why do we need such a small p-value to achieve significance?arrow_forwardStreptococcus pneumoniae cells of genotype str s mtl - are transformed by donor DNA of genotype strr mtl+ and (in a separate experiment) by a mixture of two DNAs with genotypes strr mtl - and str s mtl+. The accompanying table shows the results.a. What does the first row of the table tell you? Why? b. What does the second row of the table tell you? Why?arrow_forward
- What is the purpose of conducting a modified Furter-Meyer Test? What is the principle behind this test? How could you identify the positive result for this test?arrow_forwardWhy should there be 3 banding techniques (G, Q, and R)? Aside from their differences in appearance and procedure, what is unique to each one of them? or what can one banding technique show that the others cannot?arrow_forwardFollowing a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates (ddNTP's), separation of the primer reaction products was achieved using capillary gel electrophoresis. In the following example, ddATP was labeled with a 'green' fluorophore, ddTTP was labeled with 'red', ddCTP was labeled with 'black', and ddGTP was labeled with 'blue. From left to right (i.e., the shortest to longest retention time), the sequence was: AACGGTTGTCTCTGATTTGTATTATGTT. What is the sequence of the template DNA, from its 3' to 5' end? о ТTIGCCAACAGAGACTAAACATААТАСАА O TTGTATTATGTTTAGTCTCTGTTGGCAA О ААСАТААТАСАААТСAGAGAСAАССGTT O AACGGTTGTCTCTGATTTGTATTATGTTarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY