Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 6, Problem 19PDQ
If further testing of the mutations in Problem 18 yielded the following results, what would you conclude about mutant 5?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
You are interested in studying resistance to heavy metals and have selected the yeast Saccharomyces cerevisea to conduct your studies. You have recovered a deletion mutant that does not tolerate high concentrations of zinc (grows poorly in zinc containing media ) and have designated the mutant pgz-1 (for poor growth in zinc ). (a) What is the advantage to the type of mutant used in this work? What class of mutagen was likely use to generate pgz-1?
( b) Do you expect the PGZ gene to be expressed in your mutant? Explain.
After mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B) that, unlike the wild type cells, fail to luminesce when grown to high density in a flask with appropriate medium. Curiously, however, when you inoculate both mutant strains in the same flask, you observe that the mixed (A+B) culture begins to emit light after growing dense.
a) What gene/functions are likely affected in each of the two mutants?
b) How does this explain their phenotypes?
Chapter 6 Solutions
Concepts of Genetics (12th Edition)
Ch. 6 - When the interrupted mating technique was used...Ch. 6 - In a transformation experiment involving a...Ch. 6 - In complementation studies of the rII locus of...Ch. 6 - A 4-month-old infant had been running a moderate...Ch. 6 - Prob. 2CSCh. 6 - Prob. 3CSCh. 6 - Prob. 4CSCh. 6 - HOW DO WE KNOW? In this chapter, we have focused...Ch. 6 - Review the Chapter Concepts list on p. 123. Many...Ch. 6 - With respect to F+ and F bacterial matings, answer...
Ch. 6 - List all major differences between (a) the F+ F...Ch. 6 - Describe the basis for chromosome mapping in the...Ch. 6 - In general, when recombination experiments are...Ch. 6 - Why are the recombinants produced from an Hfr F...Ch. 6 - Describe the origin of F bacteria and merozygotes.Ch. 6 - In a transformation experiment, donor DNA was...Ch. 6 - Describe the role of heteroduplex formation during...Ch. 6 - Explain the observations that led Zinder and...Ch. 6 - Prob. 12PDQCh. 6 - Two theoretical genetic strains of a virus (abc...Ch. 6 - The bacteriophage genome consists of many genes...Ch. 6 - If a single bacteriophage infects one E. coli cell...Ch. 6 - A phage-infected bacterial culture was subjected...Ch. 6 - In recombination studies of the rII locus in phage...Ch. 6 - In an analysis of rII mutants, complementation...Ch. 6 - If further testing of the mutations in Problem 18...Ch. 6 - Using mutants 2 and 3 from Problem 19, following...Ch. 6 - During the analysis of seven rII mutations in...Ch. 6 - In studies of recombination between mutants 1 and...Ch. 6 - Prob. 23ESPCh. 6 - An Hfr strain is used to map three genes in an...Ch. 6 - A plaque assay is performed beginning with 1 mL of...Ch. 6 - In a cotransformation experiment, using various...Ch. 6 - For the experiment in Problem 26, another gene, g,...Ch. 6 - Bacterial conjugation, mediated mainly by...Ch. 6 - A study was conducted in an attempt to determine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If you wanted to make a mouse model for any of the following human genetic conditions (a–d), indicate which of thefollowing types of mice (i–vi) would be useful to your studies. If more than one answer applies, state which type ofmouse would most successfully mimic the human disease:(i) transgenic mouse overexpressing a normal mouse protein; (ii) transgenic mouse expressing normal amounts of amutant human protein; (iii) transgenic mouse expressing adominant negative form of a protein; (iv) a knockout mouse;(v) a conditional knockout mouse; and (vi) a knockin mousein which the normal allele is replaced with a mutant allelethat is at least partially functional. In all cases, the transgeneor the gene that is knocked out or knocked in is a form of thegene responsible for the disease in question.a. Marfan syndrome (a dominant disease caused byhaploinsufficiency for the FBN1 gene);b. A dominantly inherited autoinflammatory diseasecaused by a hypermorphic missense mutation in thegene PLCG2;c.…arrow_forwardThe following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…arrow_forwardA classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimethoprim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mammalian cell mutants defective in thymidylate synthase?arrow_forward
- A classic way to isolate thymidylate synthase-negative mutants of bacteria is to treat a growing culture with thymidine and trimetho- prim. Most of the cells are killed, and the survivors are greatly enriched in thymidylate synthase-negative mutants. (a) What phenotype would allow you to identify these mutants? (b) What is the biochemical rationale for the selection? (That is, why are the mutants not killed under these conditions?) (c) How would the procedure need to be modified to select mam- malian cell mutants defective in thymidylate synthase?arrow_forwardFour cosmid clones, which we will call cosmids A, B, C, and D, werehybridized to each other in pairwise combinations. The insert size ofeach cosmid was also analyzed. The following results were obtained:arrow_forwardIn problem 2e, how can you identify added mutations?arrow_forward
- A site-directed mutagenesis experiment was done on the catalytic triad of the serine protease subtilisin where all of the amino acids of the catalytic triad were mutated to alanine. The triple mutant enzyme was characterized kinetically and the mutant displayed a thousand-fold (103) rate enhancement over the uncatalyzed reaction. Explain the source of this rate enhancement. (The native wild-type subtilisin has a rate acceleration of 1010, when compared to the uncatalyzed reaction.)arrow_forwardThe mutations produced by the following numbered compounds can be reversed by the substances shown. What conclusions can you draw about the nature of the mutations originally produced by these compounds?arrow_forwardThe DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm. How many base pairs are missing from this mutant? *arrow_forward
- Which one of these is correct ? And why are the rest incorrect?arrow_forwardFrom Table 20-3, would you expect the noncoding mutation g4205a to be fixed before or after the coding mutation G238S in a population of bacteria evolving resistance to the antibiotic cefotaxime? Give at least tworeasons for your answer.arrow_forwardClary Fray used the pET vector system to express her prokaryotic amylase enzyme. She added peptone into her culture broth of BL21(DE3) Escherichia coli strain to induce protein expression. At the end of the experiment, she discovered that her protein was not expressed. She repeated three more times but her protein of interest was still not produced. (i) (ii) (iii) (iv) (v) Explain the reason why Clary failed to obtain her protein of interest and suggest a solution to troubleshoot this problem. Clary plans to express her protein along with a polyhistidine-tag. Explain the importance of His-tag in protein work. Is DH5a Escherichia coli suitable to propagate the plasmid before protein expression? Besides heat shock method, elaborate another procedure Clary could utilize to transform the recombinant pET vector into the host cell. If her supervisor instructs her to express a gene from gold fish (Carassius auratus), is the expression system she is using now suitable for this experiment?…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY