min 3' 5' +1 ! in m 3' Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand

min 3' 5' +1 ! in m 3' Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand

Name: Part I. Structure-Function Relationships in Genes1. Consider the "two
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Part I. Structure-Function Relationships in Genes1. Consider the "two-line model" of a gene shown below - each line represents onestrand of a DNA double helix, and the transcription start site is indicated as +1. Use thetwo-line models provided when

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 8P: Alternative Splicing Possibilities Suppose exon 17 were deleted from the fast skeletal muscle...

See similar textbooks

Similar questions

E32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||
DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.
in m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS -3' -5' +1 (i) Name the specific regions that can be recognized by sigma factor and indicate the locations in the diagram above. (ii) How does Sigma factor trigger the initiation of transcription?
protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Y
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
You continue to study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGIAATATĞGGGATGCACTATC 5' 3' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCA'NTATAÇCCCTACGTGATAG CACTATC promoter RNA polymerase ribosome
Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
I am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…
Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named Genetixrox and want to label themRNA with a radioactive atom. Assume the mRNA is long and contains all four standardRNA bases. Assume that the cell cannot convert ribonucleotides to deoxyribonucleotides (orvice versa).A. Will you generate radioactive Genetixrox mRNA with 3H-threonine? Threonine is an aminoacid. Answer yes or no, and provide a one sentence rationale.B. Will you generate radioactive Genetixrox mRNA with 3H-adenosine triphosphate? Answeryes or no, and provide a one sentence rationale.C. Will you generate radioactive Genetixrox mRNA with 3H-deoxyadenosine triphosphate?Answer yes or no, and provide a one sentence rationale.D. Will you generate radioactive Genetixrox mRNA 12C-with adenosine triphosphate? Answeryes or no, and provide a one sentence rationale
RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)