Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 2PDQ
Review the Chapter Concepts list on p. 238. These all relate to the translation of genetic information stored in mRNA into proteins and how chemical information in proteins impart function to those molecules. Write a brief essay that discusses the role of ribosomes in the process of translation as it relates to these concepts.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Define both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.
The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell and suggest two reasons why eukaryotic mRNA needs to be modified before translation.
In eukaryotic cells, secreted proteins are initially directed to the endoplasmic reticulum and then via the Golgi, where they are released into the extracellular environment through secretory vesicles. A more easier way would be for secretory protein-producing ribosomes to be localised to a translocon in the plasma membrane, with the protein being secreted directly during translation.
Consider three possible benefits of the more roundabout method for protein secretion versus the simpler, more straightforward approach indicated.
Chapter 13 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - Prob. 3CSCh. 13 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 13 - Review the Chapter Concepts list on p. 238. These...Ch. 13 - List and describe the role of all molecular...Ch. 13 - Contrast the roles of tRNA and mRNA during...Ch. 13 - Francis Crick proposed the adaptor hypothesis for...Ch. 13 -
6. During translation, what molecule bears the...Ch. 13 - Summarize the steps involved in charging tRNAs...
Ch. 13 - Each transfer RNA requires at least four specific...Ch. 13 -
9. Explain why the one-gene:one-enzyme hypothesis...Ch. 13 - Prob. 10PDQCh. 13 - Prob. 11PDQCh. 13 - Prob. 12PDQCh. 13 - Assuming that each nucleotide is 0.34 nm long in...Ch. 13 - Review the concept of colinearity in Section 12.5...Ch. 13 -
15. In your opinion, which of the four levels of...Ch. 13 -
16. List and describe the function of as many...Ch. 13 - How does an enzyme function? Why are enzymes...Ch. 13 -
18. Shown in the following table are several...Ch. 13 -
19. Three independently assorting genes are known...Ch. 13 -
20. How would the results in cross (a) of Problem...Ch. 13 - A series of mutations in the bacterium Salmonella...Ch. 13 -
22. The emergence of antibiotic-resistant strains...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider this list (below) of steps involved in translation. These steps are out of order. TRANSLATION: 1. the small and large ribosomal sub-units unite2. two amino acids join together.3. another tRNA anti-codon bonds with another mRNA codon 4. an initial tRNA bearing a specific amino acid arrives at the ribosome 5. the process continues until a protein molecule is completed6. at the synthesis site, initial mRNA codons are insertedarrow_forwardContrast transcription and translation. Name at least three differences between the two processes.arrow_forwardDescribe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.arrow_forward
- Describe translation in eukaryotes by answering each part below: - What are the players (the most important enzymes, proteins, or components)? And what does each do (specifically)? - Describe each of the three stages of translation in your own words. Be sure to include the key players in your description. - Provide one similarity between prokaryote and eukaryotic translation and two differences.arrow_forwardExplain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic ribosomes normally cannot, even in the presence of the required cofactors.arrow_forwardIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forward
- The 3 major forms of RNA (mRNA, tRNA, & rRNA) interact during translation. a) Describe the role of each form of RNA during translation.arrow_forwardExplain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardExplain post-translational modification of proteins in general with the types of reactions. Provide some examples of proteins that undergo post-translational modification. What are the protein targets, the type of reaction, and purpose or functions of this post-translational modification, then look up other resources to find other functions of lysyl-tRNA synthetase and explainarrow_forward
- EF-G is a macromolecular mimic of EF-tu. It's role in translation is to To cause the large subunit of the ribosome to disassociate with the small subunit of the ribosome Bind to the vacant A-site subsequent to peptide bond formation and resolve the hybrid state of the ribosome To recruit the signal recognition particle (SRP) to the ribosome and to facilitate synthesis of membrane proteins O To cause the large subunit to associate with the small subunit of the ribosome Shuttle an amino-acylated tRNA to the A site to initiate the peptidyl transfer reactionarrow_forwardWhat is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?arrow_forwardAll translation begin at free ribosomes in the cytosol, yet all secreted proteins are translocated into the ER. What is the one molecule that is responsible for targeting co-translationally translocated proteins to the ER and what are the three events that this molecule mediates between translational initiation and insertion into the ER?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY