Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 2CS
CASE STUDY | Crippled ribosomes
Diamond Blackfan anemia (DBA) is a rare, dominantly inherited syndrome characterized by bone marrow failure, birth defects, and a significant predisposition to cancer. Those affected with DBA usually develop anemia in the first year of life, have abnormal numbers of cell types in their bone marrow, and have an increased risk of developing leukemia and bone cancer. At the molecular level, DBA is caused by a mutation in any of 11 genes that encode ribosomal proteins. The common feature of all these mutations is the disruption of ribosome formation, ultimately affecting the stability or function of ribosomes.
Many questions about this disorder remain to be answered.
Why might some cells in the body, such as those in bone marrow, be more susceptible to ribosomal protein mutations than other cell types?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
Point mutations in multiple tumor suppressor proteins have been linked to cancer. For
example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may
result in colorectal cancer. Consider the following DNA sense strand.
3'-TAC CGG TTG TGA AGC TGA ATC-5'
(i)
(ii)
(iii)
(iv)
Derive the mRNA molecule from the given DNA strand sequence above,
paying attention to the polarity of the molecule.
Write down the polypeptide chain sequence arising from the mRNA molecule
of the question above, using the table of the genetic code (Table Q1 overleaf)
and indicate the C- and the N-terminus of the peptide chain.
Point mutations of a cytosine (C) often lead to the dysfunction of the APC
protein. Write down all possible polypeptide chains that can result from all
possible DNA mutations of cytosines, disregarding a mutation in the
MET/START and STOP codons.
I
Specify which of the point mutations identified in (d) are redundant?
GTTTTCACTGGCGAGCGTCATCTTCCTACT
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Chapter 13 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - Prob. 3CSCh. 13 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 13 - Review the Chapter Concepts list on p. 238. These...Ch. 13 - List and describe the role of all molecular...Ch. 13 - Contrast the roles of tRNA and mRNA during...Ch. 13 - Francis Crick proposed the adaptor hypothesis for...Ch. 13 -
6. During translation, what molecule bears the...Ch. 13 - Summarize the steps involved in charging tRNAs...
Ch. 13 - Each transfer RNA requires at least four specific...Ch. 13 -
9. Explain why the one-gene:one-enzyme hypothesis...Ch. 13 - Prob. 10PDQCh. 13 - Prob. 11PDQCh. 13 - Prob. 12PDQCh. 13 - Assuming that each nucleotide is 0.34 nm long in...Ch. 13 - Review the concept of colinearity in Section 12.5...Ch. 13 -
15. In your opinion, which of the four levels of...Ch. 13 -
16. List and describe the function of as many...Ch. 13 - How does an enzyme function? Why are enzymes...Ch. 13 -
18. Shown in the following table are several...Ch. 13 -
19. Three independently assorting genes are known...Ch. 13 -
20. How would the results in cross (a) of Problem...Ch. 13 - A series of mutations in the bacterium Salmonella...Ch. 13 -
22. The emergence of antibiotic-resistant strains...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which statement is FALSE? Group of answer choices Histones are very conserved at the primary sequence level in eukaryotes. Histones H2A, H2B, and H1 all contain the histone fold domain (HFD). CENPA is most closely related to histone H3. The amino terminal tail of histone H3 is the location of most of its covalent modifications. Amino terminal ends of core histones are involved in internucleosome interactions.arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forward15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…arrow_forward
- Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What effect will this mutation have on protein synthesis?arrow_forwardIPSCs are nearly identical to human embryonic stem cells in terms of gene expression, but there may be other ways in which they are not equivalent. For example, the telomeres of IPSCs often vary in length, with many IPSCs cells having telomeres shorter than those of embryonic. How might shortened telomeres affect the life-span of IPSCs or of differentiated cells derived from them?arrow_forwardDiscuss Concepts The normal form of a gene contains the nucleotide sequence: When this gene is transcribed, the result is the following mRNA molecule: In a mutated form of the gene, two extra base pairs (underlined) are inserted: What effect will this particular mutation have on the structure of the protein encoded in the gene?arrow_forward
- (5) AAG a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the figure above? c. What is the function of part d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that will recognize all the codons for this amino acid in (c).arrow_forwardmutation 5' 1 3' 5' 3' 5' 3' 4 3 Mutations in splice sites can lead to the formation of abnormal proteins. The diagram illustrates a mutation in the 3' splice site between exons 1 and 2 which prevents binding of snRNPs to that site. Which of the following consequences could be a result of this mutation? 1. The mutant mRNA contains intronic sequences. 2. The mutant MRNA is shorter compared to wild-type (original) MRNA. 3. The mutant MRNA produces a longer protein compared to wild-type (original) MRNA. 4. The mutant MRNA has exon 2 deleted. O A. 1, 2 and 3 O B. 1 and 3 O C. 2 and 4 D. 4 only O E. All of 1, 2, 3 and 4 are correctarrow_forward. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantproteinarrow_forward
- 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner and also induce conformational changes in the DNA. Describe the purpose of thses two modes of interaction with the DNA. 2. Draw the structures of the amino acid side chains that correspond to the following histone modification: a) acetylation of lysine; b) phosphorylation of serine; c) phosphorylation of histidine. How do thses modifications change the character of their respective side chain?arrow_forward10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardPlssssssssss helppppppppp, One strand of DNA reads T-A-C-G-A-G-C-T-C. Describe the steps of protein synthesis of a eukaryotic cell using the nitrogen bases of the given DNA strand. Include the following terms in your description: -DNA - mRNA -protein -tRNA -Amino acid -codon -nucleus -Ribosome -cytoplasm -transcription -translationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY