Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 8PDQ
Each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary protein structure in order for it to carry out its role. What are these sites?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
To carry out its role, each transfer RNA requires at least four specific recognition sites that must be inherent in its tertiary structure. What are they?
1) Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic information rather than double-stranded DNA? Cite multiple reasons.
2) Do miRNA and siRNA both derive from the same source? Explain.
Each transfer RNA requires at least four specific recognition sitesthat must be inherent in its tertiary protein structure in order forit to carry out its role. What are these sites?
Chapter 13 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - Prob. 3CSCh. 13 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 13 - Review the Chapter Concepts list on p. 238. These...Ch. 13 - List and describe the role of all molecular...Ch. 13 - Contrast the roles of tRNA and mRNA during...Ch. 13 - Francis Crick proposed the adaptor hypothesis for...Ch. 13 -
6. During translation, what molecule bears the...Ch. 13 - Summarize the steps involved in charging tRNAs...
Ch. 13 - Each transfer RNA requires at least four specific...Ch. 13 -
9. Explain why the one-gene:one-enzyme hypothesis...Ch. 13 - Prob. 10PDQCh. 13 - Prob. 11PDQCh. 13 - Prob. 12PDQCh. 13 - Assuming that each nucleotide is 0.34 nm long in...Ch. 13 - Review the concept of colinearity in Section 12.5...Ch. 13 -
15. In your opinion, which of the four levels of...Ch. 13 -
16. List and describe the function of as many...Ch. 13 - How does an enzyme function? Why are enzymes...Ch. 13 -
18. Shown in the following table are several...Ch. 13 -
19. Three independently assorting genes are known...Ch. 13 -
20. How would the results in cross (a) of Problem...Ch. 13 - A series of mutations in the bacterium Salmonella...Ch. 13 -
22. The emergence of antibiotic-resistant strains...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- GTP hydrolysis is used multiple times during the course of protein synthesis to advance the process forward, often irreversibly. Provide an example of a GTP-regulated step and its associated GTP binding factor that regulates a step during A) translation initiation, and also B) one that is associated with the translation elongation phase.arrow_forwardWhich RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form in which the Shine-Dalgarno sequence is within a stem-loop?arrow_forwardThree E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the same amino acid. What is the amino acid ?arrow_forward
- a) what is the genetic code and explain the properties b) list the difference between eukaryotic and prokaryotic translation initiation c) explain the role E.coli translation elongation factors.arrow_forwardTransfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides. What is the purpose of the rest of the tRNA molecule?arrow_forwardThe anticodon loop of one of the tRNA Gly molecules from Escherichia coli is as follows: a) Identify the anticodon, reading from 3’ to 5’. b) This tRNA recognizes a Gly codon. What is it? Write it from 5’ to 3’.arrow_forward
- In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the mature mRNA are involved (2 components) and b) what proteins are involved (at least 2 proteins)?arrow_forwardThe pioneer round of translation of an mRNA is very important to identify potentially dangerous mRNAs if per chance they possess aberrant in frame translational stop codons. Their detection leads to rapid degradation through the NMD pathway. What indications would the cell use to signal that an mRNA possesses an in frame stop following the pioneering read? Choose one. a) The mRNA has a shorter Poly A tail since it is not being efficiently translated b) If the cap binding protein is no longer associated with the cap it signals to the cell that the mRNA is no longer translatable. c) A stalled ribosomal complex on the mRNA is clearly detectable and since the translational machinery cannot initiate protein synthesis it is recognized as toxic and is degraded by the 26S proteasome. d) If the mRNA contains intron sequences then it is quickly recognized by the ribosomes as being abnornal and is degraded rapidly by the 26S proteasome. e) mRNA species that are still bound by key factors that…arrow_forwardEF-Tu binds all aminoacyl–tRNAs with approximately equal affinity so that it can deliver them to the ribosome with the same effi ciency. Based on the experimentally determined binding constants for EF-Tu and correctly charged and mischarged aminoacyl–tRNAs (see table), explain how the tRNA–EF-Tu recognition system could prevent the incorporation of the wrong amino acid during translation.arrow_forward
- A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the following amino acid sequence: Met-ProIle-Ser-Ala. What would be the effect on translation if the following component were omitted from the cell-free protein-synthesizing system? What, if any, type of protein would be produced? Explain your reasoning. Q. GTParrow_forwardProkaryotic mRNAs have a RBS (Ribosomal binding site). How they use RBS for translational machinery? What are the properties of RBS? Draw a simple scheme for RBS and mRNA interaction site.arrow_forwardA fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license