Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
Consider this list (below) of steps involved in translation. These steps are out of order.
TRANSLATION:
1. the small and large ribosomal sub-units unite
2. two amino acids join together.
3. another tRNA anti-codon bonds with another mRNA codon
4. an initial tRNA bearing a specific amino acid arrives at the ribosome
5. the process continues until a protein molecule is completed
6. at the synthesis site, initial mRNA codons are inserted
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following are stages of translation? Select all that apply. a.As the ribosome moves from codon to codon, amino acids brought by successive tRNAs to the ribosome form a growing polypeptide. b.A tRNA binds to the second codon and its carried amino acid forms a peptide bond with methionine. c.When the ribosome reaches a stop codon, its subunits detach, and the mRNA and new polypeptide are released. d.Ribosomal subunits and a tRNA carrying methionine converge on the start codon of an mRNA. e.The binding of a tRNA to the third codon causes the ribosome to release the first tRNA and move to the next codon.arrow_forwardWhat are two advantages for circularizing the mRNA during the process of eukaryotic translation? (Select two correct answers) mRNA circularization ensures that translation terminates at the proper termination codons. mRNA circularization facilitates the binding of the ribosome to the Shine-Dalgarno sequence. mRNA circularization ensures that a full-length mRNA is used in the process of translation. mRNA circularization eliminates the requirement for translation factors in the process of translation initiation. mRNA circularization allows for a more efficient re-initiation of the translation process during repeated cycles of translation.arrow_forwardVaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs in the eukaryotic cells it infects. Besides allowing degradation of the host’s mRNA, what step in translation of the host’s mRNAs does this prevent? Group of answer choices Movement of tRNA from the A site to the P site tRNA binding to the A site Recognition of the stop codon Ribosome small subunit from binding mRNA Movement of the tRNA from the P site to the A sitearrow_forward
- In the elongation stage of translation, which of the following options is correct? the polypeptide chain grows from the C terminus to the N terminus. O the mRNA is read in a 3'-to-5' direction. O rRNA is catalytically active. O tRNA is catalytically active. O peptidyl transferase activity is catalyzed by a ribosomal protein.arrow_forwardWhich of the following mRNA codons could be changed to a stop codon by a single base pair substitution in DNA ? [In other words, if you substitute one of the bases for a diferent one, it will produce a stop codon. Don't overthink this. Just look at the codon as written, and see if changing any one base leads to a stop codon]. 1. UAC (tyrosine) 2. UGG (tryptophan) 3. CGA (arginine) 4. ACU (threonine) A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forwardThe synthesis of a protein requires that the amino acids that constitute the growing polypeptide chain be covalently linked to the amino acid attached to the tRNA at the aminoacyl site of the ribosome. Which of the following catalyses this reaction? Options: the aminoacyl tRNA synthetase eEF2 eEF1-GTP a large ribosomal RNA the initiator tRNA metarrow_forward
- Label the features of a tRNA by dragging the labels to the correct targets. A) Binds an amino acid B Binds MRNA Contains pseudouridine D) Contains dihydrouridinearrow_forward1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.arrow_forwardUse this mRNA coding sequence as your starting point. This sequence begins with a start codon and ends with a stop codon, so it is only looking at the region of DNA that directly encodes a protein sequence. 5’-AUGCACAAAUUAGAGUACCCCCCAGGAAGGUAG-3’ Make the following mutation in this sequence by changing/adding/removing only one nucleotide. Make the mutation easy to see (a different color, circled, something like that) A frameshift mutationarrow_forward
- Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C CUAGAC UAGAUCUGCUACUAGUAACACĞUarrow_forwardMore than one answer can be correctarrow_forwardAnswer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? [Select] • Which position shows the "A" position? [ [Select] • Which end of the RNA is the 5' end? [Select] • Which base of the anticodon "AUC" (shown in the diagram) is the 5' end? [Select] CAG GAUCAUCGUCUAGAUUGCACAAUarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education