Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 13, Problem 22PDQ
The emergence of antibiotic-resistant strains of Enterococci and transfer of resistant genes to other bacterial pathogens have highlighted the need for new generations of antibiotics to combat serious infections. To grasp the range of potential sites for the action of existing antibiotics, sketch the components of the translation machinery (e.g., see Step 3 of Figure 13–6), and using a series of numbered pointers, indicate the specific location for the action of the antibiotics shown in the following table.
| Antibiotic | Action |
| 1. Streptomycin | Binds to 30S ribosomal subunit |
| 2. Chloramphenicol | Inhibits the peptidyl transferase function of 70S ribosome |
| 3. Tetracycline | Inhibits binding of charged tRNA to ribosome |
| 4. Erythromycin | Binds to free 50S particle and prevents formation of 70S ribosome |
| 5. Kasugamycin | Inhibits binding of tRNAfmet |
| 6. Thiostrepton | Prevents translocation by inhibiting EF-G |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Various antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider the following antimicrobial drugs:
A. Seconeolitsine, known as DNA topoisomerase I inhibitor in bacteria.
(i) Explain briefly how inhibiting DNA topoisomerase I is a good mechanism of action for an antibiotic, include possible molecular machineries being targeted.
(ii) What would be an appropriate response if seconeolitsine works well by stating the state of supercoiling in bacteria.
(iii) To prove your answer (ii), you test the condition of bacterial DNA by running gel electrophoresis, one has been treated with seconeolitsine (+ sample) and the other one is not (- sample). Explain the position of each + sample and – sample band on the gel in reference to the point of origin (where you load your samples) or how far each DNA sample travel across agarose gel.
(iv) Explain why you would expect answer (iii) for each + sample and – sample.
B.…
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein
5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’
a) describe a potential mutation that may occur and the mechanism that could fix it
b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example:
Rifamycin inhibits prokaryotic RNA polymerase
Chloramphenicol blocks the transfer of the peptide from the P to A site.
a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible.
b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)
Chapter 13 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - CASE STUDY | Crippled ribosomes Diamond Blackfan...Ch. 13 - Prob. 3CSCh. 13 -
HOW DO WE KNOW?
1. In this chapter, we focused on...Ch. 13 - Review the Chapter Concepts list on p. 238. These...Ch. 13 - List and describe the role of all molecular...Ch. 13 - Contrast the roles of tRNA and mRNA during...Ch. 13 - Francis Crick proposed the adaptor hypothesis for...Ch. 13 -
6. During translation, what molecule bears the...Ch. 13 - Summarize the steps involved in charging tRNAs...
Ch. 13 - Each transfer RNA requires at least four specific...Ch. 13 -
9. Explain why the one-gene:one-enzyme hypothesis...Ch. 13 - Prob. 10PDQCh. 13 - Prob. 11PDQCh. 13 - Prob. 12PDQCh. 13 - Assuming that each nucleotide is 0.34 nm long in...Ch. 13 - Review the concept of colinearity in Section 12.5...Ch. 13 -
15. In your opinion, which of the four levels of...Ch. 13 -
16. List and describe the function of as many...Ch. 13 - How does an enzyme function? Why are enzymes...Ch. 13 -
18. Shown in the following table are several...Ch. 13 -
19. Three independently assorting genes are known...Ch. 13 -
20. How would the results in cross (a) of Problem...Ch. 13 - A series of mutations in the bacterium Salmonella...Ch. 13 -
22. The emergence of antibiotic-resistant strains...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The ribosome is the target for many important antibiotics. Distinct antibiotics inhibit various steps in the translation process. Please specify which step of the translation (one short sentence is sufficient) each antibiotic below targets (ex: kasugamycin – inhibits formation of the initiation complex) a) chloramphenicol b) tetracycline c) erythromycin d) aminoglycosides such as kanamycinarrow_forwardMatch the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7arrow_forwardWrite the terms that match the definitions given below. A) A sequence in the leader region of the mRNA thought to be responsible for routing the mRNA on the small ribosomal subunit at the beginning of translation. B) In prokaryotes, a promoter consensus sequence located 10 bases upstream from the first base transcribed. C) In eukaryotes, a promoter consensus sequence located 70 bases upstream of the first base to be transcribed. D) In eukaryotes, a promoter consensus sequence located 25 bases upstream from the first base transcribed.arrow_forward
- A newly identified protein from the cells of the Panopyra plant on Pandora was shown to inhibit translation of its target genes by binding to the 5’ UTR of the mRNA and preventing ribosome binding. A possible way this inhibition may be relieved by an sRNA would be: Group of answer choices a)The sRNA acts as a silencer, suppressing the inhibitory protein and allowing translation to take place. b)The sRNA acts as a decoy, sequestering the inhibitory protein and allowing translation to take place. c)The sRNA acts as a marker, flagging the inhibitory protein for ubiquitination and allowing translation to take place.arrow_forwardYou are interested in the activity and regulation of a protease made by the Gram-positive bacterium Geobacillus stearothermophilus. What would be the purpose of constructing each of the following: a His-tagged protease, a transcriptional GFP fusion to the protease gene, and a translational GFP fusion to the protease gene?arrow_forwardThe lac operon has 4 genes, I, Z, Y and A. For each scenario, tell me the result of the mutation, what would happen if this mutant was in the presence of lactose and why. A) Lac I is mutated/not functional - B) Lac Y is mutated/not functional -arrow_forward
- The ribosome is the target for many important antibiotics. These drugs must discriminate between bacterial and eukaryotic ribosomes to achieve drug specificity and toxicity. For the two common antibiotics below, what is their mechanism of action and why are they more toxic to bacteria than eukaryotes? a) Tetracycline b) Erythromycinarrow_forward1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells? b)Provide an example of post-translational regulation of protein activity and explain the advantage of regulating each protein/process at the post-translational level instead of the transcriptional level.arrow_forwardAntibiotics act by different mechanisms to control microbial growth. You are given two different antibiotics and asked to check for mechanism of action whether as transcription or translation inhibition. How are you going to verify that experimentally?arrow_forward
- A number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. O CAP+ r* p* o* z O CAP* I P* o* z* O CAP* r* P O* z* O CAP I P* O z*arrow_forwardThe following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNAarrow_forwardGiven the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium. Will there be a complete set ofgene products? (Yes/No) Will the lac operon be turnedon/off? Will the cell survive? (Yes/No) a. i + p + o + z - y + b. i + p - o + z + y + c. i + p + o - z + y +arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license