The way in which variable penetrance of the Diamond Blackfan Anemia (DBA) can help in studying the molecular events that cause the disorder. Introduction: DBA is classified as an autosomal dominant disorder that is caused by a mutation in one of the 11 genes that code for ribosomal proteins. An individual suffering from this disease is born with birth defects, bone marrow failure, and also has a tendency to develop cancer. Genetic disorders are caused by the abnormalities of the genome. These disorders are inherited as the genetic information from both the parents is passed down to the progeny. DBA is caused by a mutation in the genes that code for ribosomal protein. The symptoms of this disorder vary from individual to individual. Some of them include fast heartbeat, heart murmur, a pale skin, and birth defects, such as abnormality of the hands, heart, face, kidneys, head, or genital area.

Question

Want to see the full answer?

Answer 1

Question

Chapter 13, Problem 3CS

Summary Introduction

To review:

The way in which variable penetrance of the Diamond Blackfan Anemia (DBA) can help in studying the molecular events that cause the disorder.

Introduction:

DBA is classified as an autosomal dominant disorder that is caused by a mutation in one of the 11 genes that code for ribosomal proteins. An individual suffering from this disease is born with birth defects, bone marrow failure, and also has a tendency to develop cancer.

Genetic disorders are caused by the abnormalities of the genome. These disorders are inherited as the genetic information from both the parents is passed down to the progeny. DBA is caused by a mutation in the genes that code for ribosomal protein. The symptoms of this disorder vary from individual to individual. Some of them include fast heartbeat, heart murmur, a pale skin, and birth defects, such as abnormality of the hands, heart, face, kidneys, head, or genital area.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.

Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA mutations of cytosines, disregarding a mutation in the MET/START and STOP codons. I Specify which of the point mutations identified in (d) are redundant?

GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…