Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 12, Problem 2CS
CASE STUDY | A drug that sometimes works
A 30-year-old woman with β-thalassemia, a recessively inherited genetic disorder caused by absence of the hemoglobin β chain, had been treated with blood transfusions since the age of 7. However, in spite of the transfusions, her health was declining. As an alternative treatment, her physician administered 5-azacytidine to induce transcription of the fetal β hemoglobin chain to replace her missing β chain. This drug activates gene transcription by removing methyl groups from DNA. Addition of methyl groups silences genes. However, the physician expressed concern that approximately 40 percent of all human genes are normally silenced by methylation. Nevertheless, after several weeks of 5-azacytidine treatment, the patient's condition improved dramatically. Although the treatment was successful, use of this drug raises several important questions.
What genes might raise the greatest concern?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
5
5
S
6
5
5
5
6 U
6
U
6
5:14 PM | 0.2KB/s
HHHHH
R
R
U
RUUR ARU
AP
AP
R
U
U
R
R
AP
R
R
R
AP
MOLECULAR...GENETICS.
Describe gene regulation at transcription level.
Explain the role of antsense RNA in control mechanism.
Describe translational control mechanisms.
Describe common DNA damages.
Distinguish excision and mismatch repair.
Describe the role of recA protein in recombination repair
Elaborate on SOS repair mechanism.
Define thymine dimer. How are they formed and repaired?
Describe the molecular basis of mutation.
11
Leu+
Met+
Arg+
Write a detailed note on spontaneous mutation.
Explain about mutant detection methods.
Define reverse mutation. Describe the mechanism underlying Intragenic and
intergenic suppressor mutations
Describe the transposition mechanisms.
13
Vo
LTE
UNIT IV
Time (Min)
Describe the process of generalised transformation occurring in bacterial
chromosome and plasmid.
Elaborate on molecular mechanism and significance of transformation
22
Describe the process of…
E17. Gene mutagenesis is also used to explore the structure and function
of proteins. For example, changes can be made to the coding
sequence of a gene to determine how alterations in the amino acid
sequence affect the function of a protein. Let's suppose that you are
interested in the functional importance of a particular glutamic acid
(an amino acid) within a protein you are studying. By site-directed
mutagenesis, you make mutant proteins in which this glutamic
acid codon has been changed to other codons. You then test the
encoded mutant proteins for functionality. The results are as follows:
Functionality (%)
Normal protein
100
Mutant proteins containing
Тугosine
Phenylalanine
3
Aspartic acid
94
Glycine
From these results, what would you conclude about the functional
significance of this glutamic acid within the protein?
. One way to determine where inside a cell a protein(protein X) normally localizes is to generate a reportergene construct containing: (i) the gene X regulatoryregion and coding sequences, and (ii) coding sequencesfor GFP fused in frame to the 3′ end of the gene Xcoding sequences just before the stop codon. A mousecontaining such a transgene will express a hybrid protein X-GFP only in those cells in which gene X is normally expressed.a. The gene X-GFP fusion gene described could begenerated by knocking in GFP coding sequencesinstead of by random insertion of a transgene.Diagram the knockin construct you could use forthis purpose.b. What might the advantage be of the knockin strategy versus the transgene strategy?
Chapter 12 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 12 - CASE STUDY | A drug that sometimes works A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 12 - Review the Chapter Concepts list on p. 215. These...Ch. 12 - In studies of frameshift mutations, Crick,...Ch. 12 -
4. The mRNA formed from the repeating...Ch. 12 - In studies using repeating copolymers, AC......Ch. 12 - Prob. 6PDQCh. 12 - Prob. 7PDQ
Ch. 12 -
8. When the amino acid sequences of insulin...Ch. 12 - Prob. 9PDQCh. 12 - Why doesn't polynucleotide phosphorylase (Ochoa's...Ch. 12 - Refer to Table 12.1. Can you hypothesize why a...Ch. 12 -
12. Predict the amino acid sequence produced...Ch. 12 - A short RNA molecule was isolated that...Ch. 12 - A glycine residue exists at position 210 of the...Ch. 12 - Shown here is a theoretical viral mRNA sequence...Ch. 12 -
16. Most proteins have more leucine than...Ch. 12 - Define the process of transcription. Where does...Ch. 12 - Describe the structure of RNA polymerase in...Ch. 12 - In a written paragraph, describe the abbreviated...Ch. 12 - Messenger RNA molecules are very difficult to...Ch. 12 - One form of posttranscriptional modification of...Ch. 12 - In a mixed copolymer experiment, messages were...Ch. 12 -
23. Shown in this problem are the amino acid...Ch. 12 - Alternative splicing is a common mechanism for...Ch. 12 - The genetic code is degenerate. Amino acids are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- E22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |arrow_forwardin m 5'- 3'- Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS -3' -5' +1 (i) Name the specific regions that can be recognized by sigma factor and indicate the locations in the diagram above. (ii) How does Sigma factor trigger the initiation of transcription?arrow_forwardGTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.arrow_forward
- a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Can you be sure?arrow_forwarda. Why is it impossible to induce nonsense mutations(represented at the mRNA level by the triplets UAG,UAA, and UGA) by treating wild-type strains with mutagens that cause only A• G → T• C transitions in DNA?b. Hydroxylamine (HA) causes only G• C → A• T transitions in DNA. Will HA produce nonsense mutations inwild-type strains?c. Will HA treatment revert nonsense mutations?arrow_forward. a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Canyou be sure?arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…arrow_forwardTransforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.arrow_forwardPlz do explain.Thanks Question:- Many types of breast cancer have chromosomal translocation mutations. What scenario best describes, what occurs during this type of mutation, causing cells to proliferate abnormally? Chromosomal translocations may place the gene downstream near the promoter region, therefore causing over-expression of the gene The gene may be placed in the transcription start site, downstream of the gene, initiating transcription by recruiting polymerase II Translocation mutations will initiate the transcription of mRNA in the cytoplasm of the cell catalyzing protein synthesis. Chromosomal translocations can sometimes place a gene under the control of a powerful enhancer, upstream.arrow_forward
- A 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.arrow_forwardMethylation state of cytosines at the QRT gene promoter is tested in one pair of identical twins, Ana and Becca, at 1 year of age, again when they are 25 years old. At 1 year old, the twins' DNA is the same, and this part of the genome is not methylated. At age 25, Ana's DNA remains unmethylated, but Becca's cells show methylation at this site in skin cells. a. What most likely caused this change in Becca? i. A mutation event ii. An environmental stimulus b. When the twins were 1 year old, QRC mRNA was expressed at similar levels in both Ana and Becca. At age 25, which twin likely expresses more of the QRC mRNA? i. Ana, whose QRC promoter DNA is unmethylated ii. Becca, whose QRC promoter DNA is methylated iii. Both are the same C. At age 25, which twin has more tightly packed chromatin in the region of the QRC gene? Explain briefly. i. Ana, whose QRC promoter DNA is unmethylated ii. Becca, whose QRC promoter DNA is methylated iii. Both are the same d. Some of Becca's skin cells, in…arrow_forwardThe table shows the partial sequences of a wild type polypeptide and three mutant polypeptides as well as the type of single nucleotide mutation that produced each mutant polypeptide. Peptide sequence Met - Leu - Arg - Ile - ... Type of mutation Wild type Met - Leu - Arg - Met - ... Met - Leu - [STOP] Mutant 1 transition Mutant 2 transversion Mutant 3 Met - Phe - Arg - Ile - ... transition Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond to each amino acid. The first codon has been filled in for you. Codon information can be found in the codon access table. Met Leu Arg Ile Answer Bank CỦA AUA CGU CGA AUG AUC AGA UUG CÚCarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY