Many types of breast cancer have chromosomal translocation mutations. What scenario best describes, what occurs during this type of mutation, causing cells to proliferate abnormally? Chromosomal translocations may place the gene downstream near the promoter region, therefore causing over-expression of the gene The gene may be placed in the transcription start site, downstream of the gene, initiating transcription by recruiting polymerase II Translocation mutations will initiate the transcription of mRNA in the cytoplasm of the cell catalyzing protein synthesis. Chromosomal translocations can sometimes place a gene under the control of a powerful enhancer, upstream.

Many types of breast cancer have chromosomal translocation mutations. What scenario best describes, what occurs during this type of mutation, causing cells to proliferate abnormally? Chromosomal translocations may place the gene downstream near the promoter region, therefore causing over-expression of the gene The gene may be placed in the transcription start site, downstream of the gene, initiating transcription by recruiting polymerase II Translocation mutations will initiate the transcription of mRNA in the cytoplasm of the cell catalyzing protein synthesis. Chromosomal translocations can sometimes place a gene under the control of a powerful enhancer, upstream.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter16: Regulation Of Gene Expression

Section: Chapter Questions

Problem 14TYK

See similar textbooks

Similar questions

E27. A cloned gene fragment contains a regulatory element that is recog- nized by a regulatory transcription factor. Previous experiments have shown that the presence of a hormone results in transcriptional acti- vation by this transcription factor. To study this effect, you conduct a electrophoretic mobility shift assay and obtain the following results: Tube: 1 2 3 Transcription factor: Hormone: Explain the action of the hormone.
MATCH THE FF. WITH THE CHOICES BELOW group of genes one long mRNA with complementary codes of 3 or more genes controlled by negative regulation a tetrameric protein, is the lacI gene product It is a palindromic DNA segment at the upstream region of lac gene has a DNA-binding domain on N-terminus; the C-terminus binds inducer, forms tetramer. an accessory protein to activate transcription regulated both positively and negatively by AraC regulatory elements of arabinose operon It is Regulated Through a Co-Repressor-Mediated Negative Control Circuit an example of autogenous regulation has attenuation regulation mechanism CHOICES: -lac operator -Catabolite activator protein -araBAD Operon -polycistronic mRNA -trp Operon -lac operon -lac repressor -Operon -AraC gene
. Analysis of p53 gene mutations in human tumors shows that a large proportion of these mutations involve GC→ AT transitions origi- nating at sites of DNA methylation. Propose a model to explain pref- erential mutagenesis of this type at these sites.
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
Q. The nuclear membrane disintegrates late in prophase of mitosis in most eukaryotic cells. Once the membrane is reformed in telophase in a daughter cell, several components of gene expression might therefore be “caught” out in the cytoplasm when they would otherwise only ever be found inside the nucleus. Consider where the following components of gene expression are made and where they function. Which component is normally never found in the cytoplasm outside the nucleus? spliced intron RNA polymerase snRNA DNA polymerase A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 & 4 are correct
E32. In the technique of DNase I footprinting, the binding of a protein to a region of DNA protects that region from digestion by DNase I by blocking the ability of DNase I to gain access to the DNA. In the DNase I footprinting experiment shown here, a researcher began with a sample of cloned DNA 400 bp in length. This DNA contained a eukaryotic promoter for RNA polymerase II. The assembly of general transcription factors and RNA polymerase II at the core promoter is described in Chapter 12 (see Figure 12.14). For the sample loaded in lane 1, no proteins were added. For the sample loaded in lane 2, the 400-bp fragment was mixed with RNA polymerase II plus TFIID and TFIIB. 2 400 350 250 175 50 Which region of this 400-bp fragment of DNA is bound by RNA polymerase II and TFIID and TFIIB? || III ||| | ||||
Editing during DNA replication is provided by DNA polymerase enzymatic activity of O 5'-> 3' polymerase 3'-> 5' polymerase O 3'-> 5' exonuclease O an extra enzyme that binds to DNA polymerase O 5'-> 3'exonuclease
a. How do bacteria increase the efficiency of gene expression? Is this possible in eukaryotes? b. A mutation in the promoter of Gene K disrupts an enzyme binding site and results in the loss of Gene K expression. Is this change in gene expression likely happening at the transcriptional or the translational level? Explain. c. Propose three different mutations to prevent initiation, elongation, and termination of bacterial transcription, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)
Q1/ There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ. c) Although eukaryotic and prokaryotic RNA polymerases are homologous to one another, defend the unsuitable use of prokaryotic RNA polymerase for transcription of eukaryotic gene.
-If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
. The tac promoter, an artificial promoter made from a chemically syn- thesized oligonucleotide, has been introduced into a plasmid. It is a hybrid of the lac and trp promoters, containing the – 35 region of one and the – 10 region of the other. This promoter directs transcription initiation more efficiently than either the trp or lac promoters. Why?

SEE MORE QUESTIONS

Recommended textbooks for you

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

GET THE APP

About FAQ Academic Integrity Sitemap Document Sitemap

Contact Bartleby Contact Research (Essays)High School Textbooks Literature Guides Concept Explainers by Subject Essay Help Mobile App

GET THE APP

Privacy

Your CA Privacy Rights

Your NV Privacy Rights

About Ads

Manage My Data

bartleby, a Learneo, Inc. business

		Chromosomal translocations may place the gene downstream near the promoter region, therefore causing over-expression of the gene
		The gene may be placed in the transcription start site, downstream of the gene, initiating transcription by recruiting polymerase II
		Translocation mutations will initiate the transcription of mRNA in the cytoplasm of the cell catalyzing protein synthesis.
		Chromosomal translocations can sometimes place a gene under the control of a powerful enhancer, upstream.