Concept explainers
HOW DO WE KNOW?
In this chapter, we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions:
(a) How did we determine the compositions of codons encoding specific amino acids?
(b) How were the specific sequences of triplet codes determined experimentally?
(c) How were the experimentally derived triplet codon assignments verified in studies using bacteriophage MS2?
(d) How do we know that mRNA exists and serves as an intermediate between information encoded in DNA and its concomitant gene product?
(e) How do we know that the initial transcript of a eukaryotic gene contains noncoding sequences that must be removed before accurate translation into proteins can occur?
Want to see the full answer?
Check out a sample textbook solutionChapter 12 Solutions
Essentials of Genetics (9th Edition) - Standalone book
- During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer.arrow_forwardSickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…arrow_forwardThe genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lysarrow_forward
- What is the biological significance of the extensive degeneracy of the genetic code?arrow_forwardI are studying pancreatic islet cells and have isolated, cloned, and sequenced a novel protein that you postulate has 4 transmembrane segments. Explain why the sequence would lead to this hypothesis (what procedure would I have applied).arrow_forwardAs we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimental information verifies that certain codonsin mRNA specify chain termination during translation?arrow_forward
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardHow does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to attach the proline to?Question 24 options: A) the synthetase recognizes the sequence of the first 3 bases on the 3' end of the tRNA B) the synthetase reads the anticodon as well as a few other unique bases in tRNAPro C) proline only fits into the 3-dimensional structure of the tRNAPro D) the synthetase randomly chooses a tRNAarrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.arrow_forwardUsing a table that shows which codon represents which amino acid determine the following: A) The possible codons that encode Serine: B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:arrow_forwardAs we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimentally derived information led to Holley’sproposal of the two-dimensional cloverleaf model of tRNA?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education