Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 13PDQ
A short RNA molecule was isolated that demonstrated a hyper-chromic shift indicating secondary structure (see p. 175 in Chapter 9). Its sequence was determined to be
5'-AGGCGCCGACUCUACU-3'
(a) Propose a two-dimensional model for this molecule.
(b) What DNA sequence would give rise to this RNA molecule through transcription?
(c) If the molecule were a tRNA fragment containing a CGA anticodon, what would the corresponding codon be?
(d) If the molecule were an internal part of a message, what amino acid sequence would result from it following translation? (Refer to the code chart in Figure 12–7.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3'
3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5'
(a) Assuming that transcription starts with the first C in the template strand, and continues to
the end, what would be the sequence of the MRNA derived from this fragment?
(b) Find the initiation and stop codons in this MRNA.
(c) Would there be an effect on translation of changing the fourth T in the template strand to a
C? If so, what effect?
Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′
in m
5'-
3'-
Shown below is a schematic diagram illustrating a very short gene with 3000 bp region of an
unknown Escherichia coli genome. (Note: Transcription starts at Transcription Start Site
(TSS).)
TSS
-3'
-5'
+1
(i)
Name the specific regions that can be recognized by sigma factor and indicate the
locations in the diagram above.
(ii)
How does Sigma factor trigger the initiation of transcription?
Chapter 12 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 12 - CASE STUDY | A drug that sometimes works A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 -
CASE STUDY | A drug that sometimes works
A...Ch. 12 - HOW DO WE KNOW? In this chapter, we focused on the...Ch. 12 - Review the Chapter Concepts list on p. 215. These...Ch. 12 - In studies of frameshift mutations, Crick,...Ch. 12 -
4. The mRNA formed from the repeating...Ch. 12 - In studies using repeating copolymers, AC......Ch. 12 - Prob. 6PDQCh. 12 - Prob. 7PDQ
Ch. 12 -
8. When the amino acid sequences of insulin...Ch. 12 - Prob. 9PDQCh. 12 - Why doesn't polynucleotide phosphorylase (Ochoa's...Ch. 12 - Refer to Table 12.1. Can you hypothesize why a...Ch. 12 -
12. Predict the amino acid sequence produced...Ch. 12 - A short RNA molecule was isolated that...Ch. 12 - A glycine residue exists at position 210 of the...Ch. 12 - Shown here is a theoretical viral mRNA sequence...Ch. 12 -
16. Most proteins have more leucine than...Ch. 12 - Define the process of transcription. Where does...Ch. 12 - Describe the structure of RNA polymerase in...Ch. 12 - In a written paragraph, describe the abbreviated...Ch. 12 - Messenger RNA molecules are very difficult to...Ch. 12 - One form of posttranscriptional modification of...Ch. 12 - In a mixed copolymer experiment, messages were...Ch. 12 -
23. Shown in this problem are the amino acid...Ch. 12 - Alternative splicing is a common mechanism for...Ch. 12 - The genetic code is degenerate. Amino acids are...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?arrow_forwarda) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forward26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The direction of the RNA polymerase is given by the arrow. 26) Direction of RNA polymerase amino acid O00000000 large of rib ribosome polypeptide chains B (a) Is the letter A nearer the 5' or the 3' end of the molecule? (b) Is the letter B nearer the 5' or the 3' end of the molecule? (c) Is the letter C nearer the 5' or the 3' end of the tRNA molecule? (d) What is the "S" value for the large rRNA that is closest to the letter D? (e) Which terminus (N or C) of the growing polypeptide chain is nearer to the letter E?arrow_forward
- For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site, (b) template strand, and (c) promoter.arrow_forwardThe following represent deoxyribonucleotidesequences in the template strand of DNA:Sequence 1: 5'@CTTTTTTGCCAT@3'Sequence 2: 5'@ACATCAATAACT@3'Sequence 3: 5'@TACAAGGGTTCT@3'(a) For each strand, determine the mRNA sequencethat would be derived from transcription.(b) determine the amino acidsequence that is encoded by these mRNAs.(c) For Sequence 1, what is the sequence of the codingDNA strand?arrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forward
- The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forwardA double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.arrow_forward5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?arrow_forward
- The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardRNA polymerases generally require a primer to begin transcription. (T) (F) The Death Cap Mushroom Amanita phalloides is toxic because of its ability to produce alpha-amanitin, which is an inhibitor of RNA Polymerases I and III. (T) (F) In bacteria, transcription and translation can occur simultaneously. (T) (F) In eukaryotes, transcription and translation can occur simultaneously (T) (F) RNA polymerase II has no form of proofreading activity. (T) (F) Sigma factors specify binding of bacterial RNA Polymerases to specific promoters (T) (F) An E. coli strain with mutations in genes encoding both the dam methylase and the RecA protein would likely be inviable (dead) (T) (F) An E. coli culture grown in a pure (100%) N2 atmosphere would likely have a lower rate of mutations than a culture grown under normal conditions (~30% O2 and 70% N2) (T) (F) Non-homologous end joining repairs double strand DNA breaks with no loss of information, restoring the original…arrow_forwardAs opposed to DNA replication or transcription, translation requires the correct reading frame. Use the sequence below to illustrate what the “reading frame” on an mRNA refers to. (A): 5’ UUGCAUUGCAGC 3’ Write out ALL of the possible reading frames for the RNA shown in part (a).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY