During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer.

Q: If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles. It includes…

Q: 64 codons specify 20 amino acids. There are two characteristics of codons: 1. No ambiguity: Each…

A: Genetic code is the sequence of nucleotides which specify amino acids.

Q: A monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many…

A: Amino acids are joined by peptide bonds to form a polypeptide. A protien is a polymer of many…

Q: How many codons are possible for an RNA trinucleotide having an adenine base, a cytosine base, and…

A: Genetic code is a triplet codon that was present on deoxynucleotide [DNA] or ribonucleotide [RNA]…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the…

A: The function of the other codons is stop codon i-e to stop the translation.

Q: Is it reasonable that codons for the same amino acid have one or two nucleotides in common? Why or…

A: Proteins are synthesized via translation of mRNA> The tripeptide sequence on the mRNA that codes…

Q: The nearly universal genetic code consists of how many codons?

A: Genes are the unit of heredity and they are made up of triplet genetic codons. These codons are…

Q: It is possible for the codons for a single amino acid to have the first two bases in common and to…

A: mRNAs contain trinucleotide sequences known as codons. The ani-codon site of the tRNA recognizes the…

Q: What would be the effect of an insertion or deletion of one of the bases in a codon?

A: Mutation may be defined as change in single or multiple base pairs resulting in altered phenotype.…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Why must a polypeptide sequence begin with a designated Start codon?

A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…

Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the…

A: From the above given question we have to show what are the three functions of remaining codons as…

Q: How many bases make up a codon?

A: The flow of genetic information from DNA to mRNA to proteins is central dogma where the process of…

Q: Given that out of the 64 codons of MRNA, 61 codify amino acids that form polypeptide chains, what…

A: As there are 20 amino acids and 64 possibilities of mRNA codons. There it is expected some amino…

Q: How many codons would exist in a genetic code that had codons that were four bases long? Why? (show…

A: The rules governing the encoding of genetic information in the DNA of living things are known as the…

Q: Codons and anticodons are both three-base sequences. How do they differ?

A: Ribonucleic acid (RNA) is of three main types namely messenger RNA (mRNA), transfer RNA (tRNA), and…

Q: Why could a codon not consist of only two bases?

A: The genetic information of DNA is based on the nucleotide base sequences. These sequences are…

Q: Which of the following is a reason why codons are NOT composed of only two nucleotides? Question 22…

A: The biochemical substance that is carried forward from the preceding generation to the succeeding…

Q: According to wobble rules, what codons should be recognized by the follow- ing anticodons? What…

A: Wobble pairing was defined as the base-pairing with two nucleotides that do not follow Watson-Crick…

Q: f you have 960 nucleotides, how many codons do you have?

A: Introduction DNA is a genetic material of our body. DNA is a self replicating molecule. The…

Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…

A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…

Q: What is the significance (or function) of tRNA in protein synthesis? In other words, explain why…

A: transfer RNA or t RNA is a small RNA molecule that participates in the protein synthesis. each t RNA…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: What codons are used and with what frequency?

A: mRNA is translated to form proteins. mRNAs contain trinucleotides sequences that are called codons.…

Q: If one codon codes for two nucleotide than how many possible codons are there?

A: To find: How many codons are possible if one codon codes for two nucleotides

Q: What is the significance of the fact that many synonymous codons differ only in the third nucleotide…

A: Codons are the three consecutive nucleotides on mRNA which specify amino acids or stop signal for…

Q: Compare the codons with a pyrimidine, either U or C, as the second base. Do the majority of the…

A: Codons are the trinucleotide sequence of DNA or RNA that codes for specific amino acids. There are…

Q: look at the code: import random # Define the DNA nucleotides nucleotides = ["A", "T", "G", "C"] #…

A: import random# Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"]The above code  defines…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: How many nucleotides in a row make one codon?

A: A codon is a sequence of DNA or RNA nucleotides that corresponds with a specific amino acid.

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: Hereditary qualities is a part of science related to the investigation of genes, hereditary variety,…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.