During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer.

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: 64 codons specify 20 amino acids. There are two characteristics of codons: 1. No ambiguity: Each…

A: Genetic code is the sequence of nucleotides which specify amino acids.

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: BLOOD DISORDER # 1: mRNA 5' TTAA tRNA nucleus m TT GIA TIT GIA GTGdr TTCCCTTGA ♫ nucleus cytoplasm…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: DNA is also called deoxyribonucleic acid. DNA act as the genetic material in all organisms except…

Q: In cells, proteins are synthesized from a gene sequence via the process of transcription and…

A: In prokaryotes cell organelles are absent. The genomic DNA of prokaryotes is found in the cytoplasm.…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: The DNA in the coding strand below contains a short imaginary sequence for a short protein in…

A: DNA sequence: 5'-ATGTACCTCGACGATCAAGGCAA-3'1. m RNA sequence:Due to complementary base pairing rules…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Decode the unknown word using the genetic code and fill out the missing nucleotides. Translate the…

A: The disorders of the blood influence or alter the functioning of the red blood cells, white blood…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: There are three termination codons (UAA, UAG, UGA) but usually only one initiation codon (AUG) is…

A: The initiation codon is also referred to as start codon which marks the beginning of the translation…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: otal nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with…

A: Although ssDNA could be a critical intermediary in practically all biological activities involving…

Q: Examine Table 15-2. What do the following codons specify:a. UAAb. UGAc. UAGWhat happens when a…

A: Step 1 Genetic codes are genetic information present in the nucleotide sequences of DNA…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…

A: Introduction  The process by which a gene's information is used to produce either RNA molecules that…

Q: Codons 24 to 66 represent an intron.  At what point in the process of protein synthesis are introns…

A: Transcribing DNA to RNA is the initial step in a long process that finally synthesizes functional…

Q: look at the code: import random # Define the DNA nucleotides nucleotides = ["A", "T", "G", "C"] #…

A: import random# Define the DNA nucleotidesnucleotides = ["A", "T", "G", "C"]The above code  defines…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: 3'-TAC TGA GCA AGA TTA CAT ACT-5' Write down the mRNA sequence for the given DNA sense strand…

A: A mutation in both copies of the HBB gene results in sickle cell disease (SCD), a hereditary…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Introduction : Transcription is the process in which a DNA sequence is transcribed into an RNA…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Which of these molecules has multiple partial charges and thus is most soluble in water? H H HHHH…

A: Most soluble in water.

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: Hereditary qualities is a part of science related to the investigation of genes, hereditary variety,…

Q: A standard codon table such as the one that we looked at in class gives the following information:

A: Three types of RNA interact to synthesize proteins. They are mRNA, tRNA, and rRNA.mRNA is the…

Q: We are given a random DNA sequence (each of the 4 bases has equal probability of occurring at each…

A: As you have posted multi-part question.I am answering only first 3. For remaining answers post them…

Q: The nucleoside inosine frequently occurs as the third base in codons. What role does inosine play in…

A: Inosine is the nucleoside made up of ribose and hypoxanthine.

Q: A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table  and give…

A: Genetics is a branch of science that deals in the study of genes, heredity, and genetic variation of…

Q: The redundancy of the genetic code means that some amino acids arespecified by more than one codon.…

A: One of the characteristic feature of genetic  code is its redundancy which makes a few amino acids…

Q: Write all possible codons recognized by each of the given anticodons. An anticodon strand reads…

A: Anticodon is a sequence of three nucleotides found on one arm of the transfer RNA, also known as the…

Q: If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the…

A: The DNA is transcribed into the RNA by the process of transcription and translation is the process…

Q: Consider this nucleotide sequence of DNA strand in the image provided.  If this strand is the sense…

A:

Q: How can the 4 nucleotides present in DNA code for the 20 different amino acids found in proteins?…

A: Adenine (A), thymine (T), guanine (G), and cytosine (C) are the four nucleotides found in DNA. These…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.