5' - ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?

RNA polymerases generally require a primer to begin transcription. (T) (F)   The Death Cap Mushroom Amanita phalloides is toxic because of its ability to produce alpha-amanitin, which is an inhibitor of RNA Polymerases I and III. (T) (F)   In bacteria, transcription and translation can occur simultaneously. (T) (F)   In eukaryotes, transcription and translation can occur simultaneously (T) (F)   RNA polymerase II has no form of proofreading activity. (T) (F)   Sigma factors specify binding of bacterial RNA Polymerases to specific promoters (T) (F)   An E. coli strain with mutations in genes encoding both the dam methylase and the RecA protein would likely be inviable (dead) (T) (F)   An E. coli culture grown in a pure (100%) N2 atmosphere would likely have a lower rate of mutations than a culture grown under normal conditions (~30% O2 and 70% N2) (T) (F)   Non-homologous end joining repairs double strand DNA breaks with no loss of information, restoring the original…

First start with a pre-MRNA with four exons and three introns and diagram the splicing reactions leading to the four exons being spliced together (a) Second, show the following two alternative splicing diagrams that would produce (b) intron 2 retention, otherwise similar to part (a) (c) mutually exclusive exon (exon 1- either exon 2 or exon 3 -- exon 4) (d) exon 2 skipping, otherwise, similar to part (a). For part (d), explain how an SR protein could influence whether exon 2 is skipped. What would happen if SR binding to the exon 2 ESE was weak? Which MRNA isoform would be more abundant?

Which amino acid would be attached to a tRNA that read "GGU"?

1 point Before we start the actual translation process. If we look at our transcript from sequence I, we can predict how long the polypeptide will be. 544545-33454454 Find the Open reading frame. Then tell me how many amino acids are in this poly-peptide? Provide a single integer Type your answer... A8885-349953-

DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ Draw a box around the sequence where RNA polymerase will bind to the DNA. What is this sequence called? Will transcription start at this sequence, to the left of this sequence (“upstream”) or, to the right of this sequence (“downstream”)? Draw a small arrow above the DNA strand where transcription will begin. Which DNA strand will RNA polymerase transcribe? Highlight this strand with your highlighter. (Hint: RNA pol is similar to DNA pol because it can only make new RNA in the 5’ to 3’ direction. Draw in an arrow to show the direction that RNA polymerase will move along the DNA strand.

Digestion of a DNA sample with Decll, which is a "4-cutter" enzyme that produces blunt (rather than "sticky") ends, generated numerous DNA fragments, including a 15 bp piece whose sequence is indicated below (note that only one of the DNA strands is specified). 5' TCTGAATTCCGTAGA 3' Based on this information, the recognition sequence for the Decll enzyme must be 5' 3. [specify using single letters]

6

34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strand