a) Examine the nudeotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5 CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2)

Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the…

A: In this question, we are given anticoding sequence of DNA. This is also called as antisense strand…

Q: (a) Assuming that transcription starts with the first C in the template strand, and continues to the…

A: The DNA carries all the genetic information. It is expressed in the form of proteins which are made…

Q: Does crude mRNA have density? if so what is the density value ? Thank You

A: Introduction mRNA is single stranded RNA. Which carries genetic information from DNA to ribosomes…

Q: a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by…

A: Hi there! Since you have posted multiple questions, we are answering only first three sub-parts:…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: Consider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA…

A: Transcription is process through which DNA is converted into mRNA.

Q: the gene above is transcribed into a functional mRNA, a.) how many codons will be carried by the…

A: The process of formation of messenger RNA with the help of template strand of DNA is called…

Q: 1. If the gene above is transcribed into a functional mRNA,  a.) how many codons will be carried by…

A: a) 64 codons will be carried by the functional mRNA, 61 represent amino acids, and the remaining…

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences…

A: The genetic information flows from the form of DNA into the form of protein and this framework is…

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Given that out of the 64 codons of MRNA, 61 codify amino acids that form polypeptide chains, what…

A: As there are 20 amino acids and 64 possibilities of mRNA codons. There it is expected some amino…

Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?

A: Codon is defined as the the group of three nucleotides that encode an amino acid.

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: . What mRNA base sequence would be obtained from the following portion of a gene?

A: Genetic information is transferred from genes to the proteins via messenger RNA.…

Q: Given a non-template strand with this sequence: 3'- G CATCGCTAGCGGCTAGA-5' What will be the sequence…

A: The Maij difference between DNA and RNA is that DNA have bases A, T, G ,C where as RNA has A,U,G,C.…

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…

A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…

Q: A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP.…

A: Introduction: The process in which RNA is synthesized from DNA is known as transcription. Therefore,…

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: Describe the process where a peptide chain is formen from a code embedded in a nucleic acid…

A: Central Dogma of molecular Biology explain how a DNA replication result into DNA, DNA is changed…

Q: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming…

A: Hello! According to guidelines we have to answer the first 3 sub-parts only. so please kingly post…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: I only need letter D and E

A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…

Q: What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating…

A: The messenger RNA (mRNA) is a molecule produced during the process of transcription where the enzyme…

Q: In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give…

A: 1 a) No, there wont be any problem in expressing the two genes. But in bacteria, most of the gene…

Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…

A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…

Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: Determine which amino acid is formed from the following mRNA codon: GUA.     a aspartic acid b…

A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…

Q: 30  A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: If the mRNA produced had the sequence ACGCGU, What would be the tRNA anticodon sequence?

A: mRNA is a messenger RNA that is synthesized from the DNA by the process called transcription. The…

Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…

A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…

Q: How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…

Q: UAG CUA UCA AAU AGA, what tRNA anticodons would be needed to translate the sequence?

A: RNA- It  stand for the ribonucleic acid.  is a nucleic acid present in all living cells and in some…

Q: what is the anticodon sequence that would build this protein?

A: The process of formation of mRNA sequence from a DNA transcript is known as translation. In mRNA,…

Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…

A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…

A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…

Q: What observations suggested the existence of mRNA?

A: The mRNA receives coded information from DNA and participates in its translation via amino acid…

Q: Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this…

A: Messenger (mRNA) ribonucleic acid helps in the formation of protein as it contains the long base…

Q: Which translation protein mimics RNA structures and why?

A: Gene expression is defined as the process of conversion of information stored in the DNA to the…

Q: Which amino acid would be attached to a tRNA that read "GGU"?

A: Introduction :  A codon is defined as a sequence of three nucleotides which together form a unit of…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Proteins

We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.  

Protein Expression

The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.