Concept explainers
The figure that follows shows part of a modified screen shot of part of the human genome as displayed on the UCSC Genome Browser. A through G map the sequences within individual cDNA clones to the genome sequence. Refer to the key in Fig. 10.3 if you need help in interpreting this diagram. Pay close attention to the vertical widths of the icons indicating exons.
How many annotated genes do you think are present in this region of the human genome?
For all annotated genes in this region, indicate whether they are transcribed in the direction from centromere to telomere or from telomere to centromere.
How many promoters are suggested by the data? Approximately where are these promoters located?
How many different proteins are encoded by the DNA sequences in this region?
What is unusual about this region of the human genome?
Trending nowThis is a popular solution!
Chapter 10 Solutions
Genetics: From Genes to Genomes
- The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data? (please do not copy and paste the answer from below. i don't think it is correct. a. MFAP3L is mostly found in the nucleus in the genome. It is found on chromosome 4 reverse strand. The protein produced by the gene is found in the cell membrane, and it is positioned on the membrane with the carboxyl side of the protein facing the cytosol. b. The MFAP3L gene is transcribed from the telomere to the centromere. c. According to the data, there are 11 different splice forms…arrow_forwardYour advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?arrow_forwardFrom the results of your BLAST search you can link to the GENE entry for one of your top hits. This link is located under the “Related Information” heading at the right hand side of each displayed alignment (i.e. scroll down to the “Alignments” section). QUESTION What is the “Official Symbol” and “Official Full Name” for this gene?arrow_forward
- A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?arrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forwardUsing the GeneEx Computer Simulation http://intro.bio.umb.edu/MOOC/jsGX/JsGenex_C2.html Complete the following Question and upload a screenshot to this assignment with your unique gene shown. (Use the Snipping Tool to capture a screenshot- it is in the start button and search for snipping tool) Design an entirely new gene that you have invented. Using the new Gene Explorer, this gene should (you can make it more challenging if you like): Produce a protein of at least five amino acids (including the N-terminal Met). Contain at least one intron. Tips 1.Use the “Enter New DNA Sequence” button and delete the starting sequence from the entry blank. 2.Type in a promoter, a little DNA, and a terminator; be sure your RNA is made. 3.Click on your gene and add the start codon, coding region, and stop codon; be sure your protein is made. Type slowly so that the program can keep up. 4. Similarly, add an intron in the coding region and be sure your gene worksarrow_forward
- A 2500 bp region of the human genome encodes two genes. One of the genes encodes a protein of 600 amino acids and the other gene encodes a protein of 280 amino acids. The mRNA sequences of the two genes do not contain any of the same nucleotide sequences (i.e. they do not overlap). How is this possible? Fully explain your answer.arrow_forwardRepresentations of sequencing chromatograms for variants of the a chain of human hemoglobin are shown here. Match each of the variants with the corresponding amino acid change. You can use the codon table to decode each amino acid sequence. For example, the first triplet encodes for Val. Normal Chongqing ddATP ddCTP ddGTP ddTTP Pro to Thr Gly to Asp Leu to Arg Karachi Swan River Answer Bank Ala to Pro Asp to Gly Pro to Ala Arg to Leu Asp to Asn Arg to Valarrow_forwardA molecular geneticist hopes to find a Gene in human liver cell that codes for an important blood-clotting protein,he knows that the nucleotide sequence of a small part of the Gene is GTGGACTGACA.briefly explain how to obtain genearrow_forward
- Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forwardIn the practical you have been analysing a human genomic library. You know from your calculations that only a small proportion of the human genome is represented, even when the entire class results are considered. Therefore, the chance of finding a particular single-copy gene in your library is very small. Outline a strategy for constructing a genomic DNA library more representative of the entire human genome. You will need to consider alternative vectors and the efficiency of transformation of the bacterial cells.arrow_forwardExamine the following sashimi plot from a transcriptomics experiment. The red peaks mostly RNA STAR on data 22; data 16; ar 34 2 1 545326 550237 555148 560059 O a. correspond to exons and represent respective coverage of exons O b. correspond to introns and represent respective coverage of intronsarrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning