Concept explainers
On your computer’s browser, view the page accessed by the URL: http://genome.ucsc.edu/cgi-bin/hgGateway
In the Search Term box at the top, type CFTR (for the CFTR gene responsible for cystic fibrosis), then hit “GO.” You will be directed to a window showing the organization of the CFTR gene on human chromosome 7. (If a list appears instead of a picture, click on the first link at the top of the list, and you will be directed to the proper window.) At the top of this window are control buttons that allow you to move your view to the left or right, zoom in (even to the level of the
a. | How many exons are in the CFTR gene? |
b. | Is the CFTR gene located on the short arm (the p arm) or the long arm (the q arm) of human chromosome 7? |
c. | In which direction is the CFTR gene transcribed: toward the centromere, or away from the centromere? Section 10.4 Now zoom out the view by 10× |
d. | What are the names of the genes that flank CFTR on either side? Are these genes transcribed from the same strand of chromosome 7 as CFTR, or from the other strand? Now zoom out 100× until the entirety of chromosome 7 is visible. |
e. | What is the approximate size of chromosome 7 in Mb? |
f. | What is the approximate location of the centromere on human chromosome 7? |
g. | What is the significance of the RefSeq genes’ appearing to pile up when you are viewing the whole chromosome? |
Want to see the full answer?
Check out a sample textbook solutionChapter 10 Solutions
Genetics: From Genes to Genomes
- Using the GeneEx Computer Simulation http://intro.bio.umb.edu/MOOC/jsGX/JsGenex_C2.html Complete the following Question and upload a screenshot to this assignment with your unique gene shown. (Use the Snipping Tool to capture a screenshot- it is in the start button and search for snipping tool) Design an entirely new gene that you have invented. Using the new Gene Explorer, this gene should (you can make it more challenging if you like): Produce a protein of at least five amino acids (including the N-terminal Met). Contain at least one intron. Tips 1.Use the “Enter New DNA Sequence” button and delete the starting sequence from the entry blank. 2.Type in a promoter, a little DNA, and a terminator; be sure your RNA is made. 3.Click on your gene and add the start codon, coding region, and stop codon; be sure your protein is made. Type slowly so that the program can keep up. 4. Similarly, add an intron in the coding region and be sure your gene worksarrow_forwardCap, EA1, and Sap are all genes/proteins of interest in this study. For each gene, what gene product is encoded and where is the gene (the literal DNA sequence) located physically in the cell? I need help fimiding this in the artticle and answer as short as possible https://www.ncbi.nlm.nih.gov/pmc/articles/PMC106848/arrow_forward"While other proteins come and go during the cell cycle, the proteins of the origin recognition complex remain bound to the DNA throughout" is true or false.arrow_forward
- As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.arrow_forwardIn Figure 5-38, precisely which gene is eventually identified from the genome sequence?arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?arrow_forward
- Friedreich ataxia (FRDA) is an autosomal recessive, neurodegenerative disease that causes a lack of voluntary coordination of muscle movements. Affected individuals are homozygous for an unusually large number (expansion) of repeats of a trinucleotide sequence (GAA) in the first intron of the X25 gene. Unaffected individuals typically have between 7 and 38 repeats of the trinucleotide (GAAGAAGAAGAA…). FRDA patients have anywhere from 66 to over 1,700 repeats. To understand how the GAA trinucleotide expansion leads to FRDA, researchers looked at X25 gene expression by extracting RNA from affected and unaffected patients and doing a northern blot analysis (see the figure below): In panel “a,” the researchers used a probe to detect X25 mRNA. In panel “b,” the researchers used a probe on a duplicate of the original blot to detect human GAPDH mRNA (GAPDH is an enzyme involved in glycolysis). The sample labeled “YR” is mRNA from yeast cells that was used as a control. Explain…arrow_forwardIn a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’arrow_forwardThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAGarrow_forward
- Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79 exons. The mature mRNA measures 14,000 and codes for a protein with 3,685 amino acids. Abnormal expression of dystrophin leads to severe symptoms like muscle weakness and fatigability, a disease that is called muscular dystrophy. Most patients with muscular dystrophy become wheelchair dependent early in life. Cardiac muscle is also affected which results typically in premature death (~ second or third decade of life). Several mutations in this gene have led to the production of low levels of dystrophin or of a defective,…arrow_forwardDuring construction of a knockout mouse, a targeting vector is introduced into mouse embryonic cells, where it integrates into the genome at a ["targeted site", "random location"] by ["homologous recombination", "nonhomologous end joining "] . Pick answers within quotation marks to fill in the blanks.arrow_forwardIn three sentences describe how Sanger sequencing worksarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education