2ith the diagram provided please write the polypeptide. sequence obtained from the translation of the black allele gene

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a…

A: The genetic material of a cell, that is, the DNA (deoxyribonucleic acid) contain various genes that…

Q: 2. Complete the leading strand and the complementary strand with the 5'and 3' ends and identify the…

A: DNA acts as the genetic material in most of the organisms present on earth. DNA is first transcribed…

Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…

A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…

Q: 3. List the sequences for the "stop" codons.

A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…

Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…

A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…

Q: 5. Hypothetically speaking, a particular protein named GOTEAM is 1,000 amino acids and is known to…

A: Each amino acid is made up of 3 nucleotides. So, 1000 amino acid protein will be made up of 1000 X 3…

Q: 1. Certain proteins that stimulate expression of a gene bind to DNA in a sequence specific manner…

A: Proteins are an important organic compound. Some proteins stimulate the expression of a gene bind to…

Q: 7. How many different mRNAs could specify the amino acid sequence met-phe-ser-pro? 8. Agene contains…

A: Ans 7: Genetic codes are triplet in nature. Genetic codons are degenerate in nature, which means,…

Q: 4. In the following figure, mark the position of the start codon, polyA, and the promotor. DNA ORF

A: The DNA sequence codes for the mRNA. DNA sequence consists of all the necessary requirements for the…

Q: 4. Assume that a new low-calorie sweetener is developed. The structure is novel and is tested with…

A: Any product that is intended for human consumption requires prior approval and usage recommendation…

Q: +1 1 4 6. 7 8 9. Transcriptional stop sequence +1 ТАTA box ATG ТАА AUG UAA Here is a diagram of a…

A: A base pair is two nucleotides that together constitute DNA ladder." A DNA nucleotide is composed of…

Q: 4. A woman with skin cancer gets a biopsy of one of her tumors taken, and a sample of her blood. DNA…

A: It is given that The sequence of blood is 5' ATGCAAGTTCTAThe sequence of the tumor is 5' ATGCAAGTCTA…

Q: 2. DNA Sequence: TAC TCC GGC TCT CcC AGT TGA ACT Mutated Sequence: TAC ICI GGC TCT CCA AGT TGA ACT…

A: Let us first convert the 3' to 5' DNA sequence into 5' to 3' mRNA sequence and will then translate…

Q: 2. Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: The RNA or ribonucleic acid is produced from the DNA by the transcription process. RNA is used for…

Q: 13. The following diagram shows the normal sequence of a particular protein, along with several…

A: Mutations are defined as the permanent alteration or change in the DNA sequence that makes up a…

Q: 1. Given the mRNA: 5'AUGCAUGACGAUCUCGUCGCG....3' a. Use the genetic code to predict the amino acid…

A: DNA is the genetic material as it contains all the information required to make all the proteins and…

Q: 7. Draw a tRNA that would recognize the codon 5' A U G 3'. What is the sequence of this tRNA's…

A: As per the guidelines we are supposed to answer only the first question in case of multiple question…

Q: Examine Figure 16.2b. Why do you think the motif of the DNA-binding protein shown is called a…

A: Deoxyribonucleic acid (DNA) binding proteins are proteins that attach to single stranded or double…

Q: 2. The yeast gene encoding a protein found in themitotic spindle was cloned by a laboratory…

A: A protein is encoded by the yeast gene that is found in the mitotic spindle. This gene is cloned by…

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the…

A: A typical eukaryotic gene is made up of exons (sequences that appear in mature mRNA) and introns…

Q: 5. Match the description to the molecule(s). Each choice will be used only once. a. DNA b. mRNA C.…

A: All these terms are related to DNA, mRNA and tRNA. DNA stands for deoxyribonucleic acid. RNA stands…

Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG

A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: 8.) Answer the following questions regarding the following DNA sequence.…

A: During transcription RNA synthesis occurs over DNA and translation or protein synthesis occurs over…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: 4. Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…

A: Introduction : In sickle cell anemia, there is single nucleotide change within the gene. Thymine…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Gene is a part of the DNA, located on a specific site on the chromosome and has a specific sequence…

Q: 33. Genes for medically important proteins can be cloned and inserted into bacteria, as shown in the…

A: Recombinant DNA is a technique discovered by scientists that allows a human gene to be inserted into…

Q: Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the…

A: Restriction fragment length polymorphism (RFLP) is a type of polymorphism that results from…

Q: The first base in the tRNA anticodon loop is also wobbling, that is one tRNA is able to pair with…

A: The DNA and RNA are composed of nucleotides. The nucleotides can form hydrogen bonds with each other…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: The coding sequence of genes that specify proteins with the same function in related species…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…

A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…

Q: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region…

A: Answer option  ll will result in shorter strand

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…

A:

Q: 8. The CAS9 enzyme (shown in red in the image below arget and cut out specific DNA sequences.

A: As you have not mentioned which part to answer, we are answering first three for you. If you want…

Q: Describe the distinguishing features of the solenoid and zigzag models

A: The solenoid and zig-zag model both describe the pattern in which DNA is packed with the help of…

Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' When translated, the -1 reading frame of the sequence above gives…

A: The mRNA codon chart is used to find the amino acid with respect to the particular codon.

Q: the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: In order to synthesize complementary strand adenine is added where thymine is present and cytosine…

Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…

A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…

Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…

A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…

Q: Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note:…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: tRNA with the anticodon 5'AGG3' carry

A: The basic constitutional unit of proteins is the amino acids. There are a total of 20 amino acids…

Q: Regarding the triple DNA code, which of the following statements is true?

A: The genetic code refers to the set of rules that all living organisms use to encode information,…

Q: 7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a…

A: When two species diverge into two separate species, the copies of a single gene in the two resulting…

Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which functions as genetic material in most…