A certain section of the coding (sense) strand of some DNA looks like this: SATGTATATCTCCAGTTAG-3 It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA S-ATGTATCATCTCCAGTTAG-3 S-ATGTATATCTCCAGTTAG-3' 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion deletion a point silent D noisy insertion O deletion point silent noisy X 5
Q: Mendel's second law of independent assortment has its basis in which of the following events of…
A: Mendel's Law of Independent Assortment, also known as the Second Law of Inheritance, is a…
Q: Based on the tree below, which statement is correct? Salamander Lizard Goat Human Salamanders are as…
A: Phylogeny is defined as the study of a species or a group of related species' evolutionary history.…
Q: 5. Which organelles release energy for plant and animal cells? A. ribosomes B. vacuoles C.…
A: The cell serves as the fundamental building block of life, encompassing cytoplasm enclosed by a…
Q: Wilson's disease is an inherited disorder caused by a mutation in the ATP7B gene. Individuals…
A: From the given pedigreees we can identify the mode of inheritance of Wilson's disease. In both…
Q: This is how a hanging-drop slide is prepared. Figure from Macedo, Wikimedia Commons, 2016. 2 3 4…
A: Observing and studying living microorganisms, such as bacteria or protozoa under a microscope can be…
Q: genetic distance
A: Genetic linkage is a pivotal concept in genetics that pertains to the propensity of genes found on…
Q: Define chromatin, and explain how solenoid fibers are constructed from DNA and histone proteins
A: Chromatin is a DNA-protein complex found in the nucleus of eukaryotic cells. It organises genetic…
Q: What is DNA and RNA? How are DNA and RNA different? Do you think there are any organisms on the…
A: It contains the genetic information for the functioning of the organism. It contains two strands.…
Q: 2.1 After studying sections 2.1 and 2.2 of Learning Unit 2, view Figure 2.1. Explain in your own…
A: Immunity means being resistant to a particular infection. There are two types of immunity present in…
Q: 1. Explain why pathogens need to attach to host cells. 2. Describe various microbial attachment…
A: The process of surface adhesion and biofilm development is a type of survival strategy in microbes,…
Q: 5. In lab, you learned that magnification and field diameter are inversely related to each other. If…
A: In microscopy, the relationship between magnification and field diameter is inverse. The field…
Q: 4. How is "free water" different from water that comes from a faucet or tap? 5. How should "free…
A: "Free water" is water that doesn't include any dissolved materials like sodium or other organic or…
Q: Based on the following information acquired using a hemocytometer, calculate: i) cell concentration*…
A: In a hemocytometer, both the stained (viable) and unstained (non-viable) cells are counted in…
Q: Which type of primate has a toothcomb? Oprosimian tarsier Onew world monkey (platyrrhine) old world…
A: Primates are group of organisms that comprises of humans, apes, as well as a monkeys.Characteristic…
Q: Which lane in the gel the gel electrophoresis experiment correspond to reaction of the circular…
A: Restriction endonucleases are specific enzymes that are responsible for cutting the phosphodiester…
Q: This figure illustrates a(n ✓ hydrolysis acid base equilibrium dehydration reaction that produces…
A: The biomolecules are the molecules present in living organisms. Cells produce biomolecules from…
Q: Tab. 20.2. Pathological structural changes of cell organelles Ribosomes -Smooth endoplasmic…
A: Cell organelles play a crucial role in maintaining the structure and function of eukaryotic cells.…
Q: DNA is isolated from concentrated ocean water. One genome is studied, and the proportion of each…
A: DNA is made of of pentose sugar, nitrogenous base, phosphate group which forms a nucleotide and each…
Q: tail docking involves amputating a portion of the tail an animal for a variety of reasons. why is…
A: Tail docking is often performed in pigs to prevent tail biting. Tail biting is a behavior in which…
Q: Write at least five uses and application of isotopes in Medical diagnostics
A: Different versions of the same element are known as isotopes. Atoms of the same element that have…
Q: The concentration of glucose in the digestive tube cell is higher than that of the digestive tube…
A: Your kidney nephrons are specifically built to maintain fluid equilibrium in the body. This includes…
Q: Human tumour viruses account for an estimated 12% to 20% of cancers worldwide and often establish…
A: Virus - can not be considered living but can use the cellular machinery of their host (living). Have…
Q: A population of buffalos is isolated such that no new buffalos can come into their territory. Which…
A: In the given circumstance, the buffalo population is experiencing isolation, which refers to the…
Q: 4. Na+ channels and Action Potential Initiation. Action potentials are often initiated at the axon…
A: The question is asking about the relationship between the density of sodium (Na+) channels and the…
Q: interpret using the punnett square below to both sets of parents (Parents A , Parents B, & Parents…
A: Sickle cell anemia is an autosomal recessive disorder, which means for disease to occur both copies…
Q: How did the mortality ratios change over time for each location? Which location faced the biggest…
A: Mortality rate is the deaths in a population. The mortality ratio can be calculated by dividing the…
Q: Identify a flowering plant in your local environment identifying the basic parts of its flower, the…
A: Flowering plants are also known as angiosperm, which mainly produces flowers and bears their seeds…
Q: Does natural selection cause micro or macro evolution? Explain.
A: On the basis of scales, at which evolution occurs, biological evolution is divided into…
Q: 44. Draw the cell membrane. Include the following: Phospholipid bilayer-Draw the hydrophilic heads…
A: The plasma membrane or the cell membrane of a cell is the external cell layer made up of…
Q: Which type of receptor alters the cytoskeleton when a ligand binds to it? Integrin receptor G…
A: Receptor are special type of structure that are found in the cell membrane. They are made up of…
Q: Which of the following DNA mutations is almost certain to result in a shorter than normal protein?
A: In the present circumstance, we possess a DNA sequence and its equivalent mRNA sequence. It is…
Q: Two unlinked genes, A and B, encode very similar enzymes involved in the production of purple flower…
A: In the given context, there are two independent genes, denoted as A and B, which play a role in the…
Q: True or False. If you have two plants of the same species growing in different conditions, the air…
A: Xylem is a specialized plant tissue responsible for transporting water and essential nutrients from…
Q: Coat color in labradors is determined by alleles of two unlinked genes, B and E. The coat colors of…
A: In the given situation, the determination of coat colour in labradors is governed by two independent…
Q: Explain how magnification improves resolution of a microscopic image. Explain what can be learned…
A: According to Bartleby guidelines, we are supposed to answer firsr tgree subparts in case of multiple…
Q: Which type of virus must contain an RNA replicase packaged in the viral particle in order to carry…
A: Viruses are organisms which fall in both living and non-living, which only considered living when…
Q: Suppose a man is heterozygous for heterochromia, an autosomal dominant disorder which causes two…
A: Chi-square is a statistical method used to assess whether observed data deviates significantly from…
Q: 8. Read over the information about Cass' 9. Review Cass' recent data under step #6 on myPLTW a.…
A: When normal people eat food containing carbohydrates, it breaks down by enzymes into sugar, which…
Q: Sort the items below into the gene therapy vector categories provided AAV vector lentiviral vector…
A: Q 14: answer :- Gene therapy is a promising field that holds the potential to treat a wide range of…
Q: Explain how the first transesterification reaction is initiated in self-splicing group I introns.…
A: There are two transesterification reactions involved in the self-splicing of group I introns. The…
Q: Describe a mechanism by which a steroid hormone might act to increase intracellular levels of cyclic…
A: In the intricate world of molecular biology, steroid hormone-receptor complexes play a pivotal role…
Q: Coat color in labradors is determined by alleles of two unlinked genes, B and E. The coat colors of…
A: The genetics of coat color in Labrador retrievers is a fascinating and complex interplay of two…
Q: Which of the following is an example of homeostasis? Choose all answers that are correct as there…
A: The body's capacity to maintain a constant internal environment in the face of external disturbances…
Q: epistasis
A: Epistasis is an intricate genetic concept wherein one gene's influence takes precedence over…
Q: Match the Vitamin or Mineral with its function Vitamin A Vitamin B (as a group) Vitamin C Vitamin D…
A: Vitamins:Essential nutrients, organic moleculesThey are needed for the normal functioning of the…
Q: MetaNeuron Lesson 4 1. Action Potential Threshold. Vary the amplitude of "Stimulus 1". What effect…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Elephants have very large heads that necessitate the need for a short, thick neck. Their short,…
A: In the animal kingdom, adaptations often arise in response to the challenges posed by their specific…
Q: I understand what autoantibodies are, but are ANAs the same thing as autoantibodies, or is there a…
A: Autoantibodies are immune system antibodies that mistakenly target and attack an individual's own…
Q: Two different genes are located on the same chromosome in rabbits. A particular female rabbit is…
A: Genes on different chromosomes are inherited independently of each other because each pair of…
Q: The tonicity of blood plasma is 0.9% NaCl (equivalent to 99.1% water and 0.9% solutes.) What is the…
A: Tonicity, unlike osmotic pressure, is only affected by solutes that cannot pass the membrane, as…
Step by step
Solved in 3 steps with 1 images
- A certain section of the coding (sense) strand of some DNA looks like this: 5'- ATGGGCCACTCATCTTAG-3' It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. I Don't Know mutant DNA 5'- ATG GGCCACAGTTCTTAG-3' 5'- ATG GG CTCATCTTAG - 3' 5'- ATG GGCCACGCATCTTAG-3' Submit type of mutation (check all that apply) ооооо O point O silent O noisy ооооо insertion deletion insertion O deletion Opoint Osilent noisy insertion O deletion ооооо Opoint silent O noisy X S Ⓒ2023 McGraw Hill LLC. All Rights Reserved. Terms of Use | Privacy Center Accessibility48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- G T-A what's called a FRAMESHIFT mutation, meaning the reading "frame" čhanging the amino acid sequence from this point forward G-Cc A-u SUBSTITUTION (one base is substituted for another) --- If a substitution changes the amino acid, it's called a MISSENSE mutation --- If a substitution does not change the amino acid, it's called a SILENT mutation --- If a substitution changes the amino acid to a "stop." it's called a NONSENSE mutation Complete the boxes below. Classify each as Deletion, Insertion or Substitution AND as either frameshift, missense, silent or nonsense (Hint: Deletion & Insertion will always be frameshif Original DNA Sequence: TACA C C T T G G C G A CGAC T ... MRNA Sequence: Au GduGilAAdk GcuadiGA stait -TrP Pen-frg-cys stop Amino Acid Sequence: Mutated DNA Sequence #1 TA C»A(T C•T T G•G C GªA C G' A C T.. What's the mRNA sequence? AUGOUTAGOAAC•CECOUGIC•UEIA amino acid sequence? Will there likely be effects? yes (Circle th metootop What type of mutation is this? NONSense…EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .Identify the various types of DNA repair mechanisms known to counteract the effects of UV radiation. Drag the terms on the left to the appropriate blanks on the right to complete the sentences. Reset Help SoS repair is dependent on a photon-activated enzyme that cleaves thymine dimers. excision repair is the process by which an endonuclease clips out UV-induced dimers, DNA photoreactivation repair polymerase III fills in the gap, and DNA ligase rejoins the phosphodiester backbone. recombinational repair uses the corresponding region on the umdamaged parental strand of the same polarity. is a process in E. coli that induces error-prone DNA replication in an effort to fill gaps by inserting random nucleotides.
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTSickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.
- Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. helpProvide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.