try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNA transcript and use the genetic code to determine the resulting amino acid sequence. Note that the given strands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end with stop codon. 1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________

Q: Compare the possible differences between a eukaryotic protein-encoding gene cloned by PCR and the sa...

A: Specific mRNAs corresponding to a gene of interest are identified and reverse transcribed to form cD...

Q: As a volunteer in a genetics lab, Professor Uhura tasked you with testing the biparental mitochondri...

A: Introduction: Drosophila melanogaster is a species of fly in the family Drosophilidae. The species i...

Q: how do you distinguish nuclear from extrachromosomal inheritance? Give a specific example.

A:

Q: i need the answer quickly

A: Marchantia is a genus of liverworts belonging to the Marchantiaceae family and the Marchantiales ord...

Q: refer to the photo below) Which has a longer life expectancy - fish or oysters?

A: As the curve c shows fish life expectancy which has an equal chance of dying at any age  And the cur...

Q: Write a conclusion that includes an analysis of various limiting factors and how they impacted popul...

A: Hares (Rabbit) in the Field Female cottontail hares (Sylvilagus floridanus) are particularly fruitfu...

Q: Reproductive effort 2. Cost of reproduction

A: Reproduction is the production of offspring. 

Q: Write a step-by-step description of a specific signal transduction pathway.

A: *signals are the chemicals can found in the extracellular fluid in body . *If these chemicals can co...

Q: you are given a printout of the sense strand of your DNA.  The printout is shown below. The first th...

A: Introduction: DNA is a double helix having a sugar-phosphate backbone like a ladder and the base pai...

Q: 38. The graphs to the right (beak sizes of two bird species on 3 islands) are evidence of Pinta Marc...

A: A species where they lives, this the habitat of that particular species and where the species perfor...

Q: Describe at least one important application of DNA technology in each of the following fields: medic...

A: These days, DNA-based technology is very common. Biotechnology is the process of manipulating living...

Q: A plasmid (a) can be used as a DNA vector (b) is a type of bacteriophage (c) is a type of cDNA (d) i...

A: A plasmid is a circular, single-stranded DNA molecule that differs from a cell's chromosomal DNA.Pla...

Q: Did you find evidence that cellular respiration occurs in plants? Explain using your data

A: Introduction Cellular Respiration:- It is the process or metabolic pathway by which cells in plants ...

Q: Discuss the types of patterns in the organ system.

A: The types of patterns in the organ system 

Q: You have isolated a true-breeding fish strain that has blue scales. Then you isolate another true- b...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Epi...

Q: differentiate desease from infection. differentiate virulence from pathogenicity.

A: This is a classical difference question in biology and in based on microbiology   

Q: A contractile vacuole_____ . a. captures prey c. expels water b. stores food d. detects light

A: Introduction Contractile vacuole is a regulating organelle found in freshwater protozoa and lower me...

Q: Female cottontail rabbits (sylvilagus floridanus) are especially fertile, able to give birth to seve...

A: Cutoff points to Growth   A female cottontail bunny (Sylvilagus floridanus) can conceive an offsprin...

Q: A scientist has discovered a strain of bacteria that can convert ethanol to pyruvate when stimulated...

A: Solution 1) The repressor of this operon is functional It is active when ethanol is absent and inact...

Q: Explain the importance of thermostable polymerase used for PCR ?

A: Introduction: Biotechnology is a discipline of science concerned with the use of biological methods ...

Q: What is the main idea of pseudoreplication in a manipulative experiment? Give an example problem of ...

A: Pseudoreplication is described as using inferential statistics to check for treatment effects with s...

Q: Explain about Multiple PCR cycles ?

A: PCR stands for a polymerase chain reaction in which multiple copies of DNA molecules can be obtained...

Q: The characterization of key features of each trimester.

A: Pregnancy has three trimesters and each has specific characteristics.The total pregnancy period last...

Q: Suppose that a cow is launched into space, far from the Sun, wearing a suit that provides it with ox...

A: Hypothermia is a dangerous and substantial reduction in body temperature. Prolonged exposure to cold...

Q: In Drosophila, sepia eyes (se), curled wings (cu) and ebony body (e) are found, in this order, on ch...

A: If genes are located on the same chromosome then they are known as linked genes. In this condition t...

Q: Based on the laws of thermodynamics, energy is never created. Where does a cell get the energy to cr...

A: Every living cells need energy for doing all the cellular processes. This energy is necessary for re...

Q: Which one are true or false

A: Central dogma is the molecular process by which stored genetic information within the DNA is transla...

Q: Transcription and Translation) and epigenetics, does epigenetics agree or run counter (contradict) t...

A: Introduction: An explanation of the transmission of genetic information inside a biological system i...

Q: Scientists suggest a major evolutionary shift may have occurred when some human populations in east ...

A: Human evolution is defined as "the process by which humans evolved on Earth from now-extinct apes." ...

Q: Analyze the graph and identify some factors that may contribute to the rotifer population leveling o...

A: Rotifers are widely distributed and can be seen in the sea and fresh waterways all over the world.

Q: Heterozygous round, homozygous green seeded plants were mated with heterozygous yellow, homozygous w...

A: Let the allele describing shape of pea be R/r. RR or Rr represents round and rr represents wrinked. ...

Q: Sex-linked trait and Sex-influenced trait (Lesson 7) 1. Hemophilia is a disease inherited as a X-lin...

A: Hemophilia is X linked recessive disorder in which disease causing allele is present on the X chromo...

Q: Mechanization of transportation has allowed mass movement of humans all around the globe in the past...

A: Globalization is a complex and multi-faceted set of processes that has a wide range of effects on hu...

Q: What is Hybridization/Annealing ?

A: Annealing which is also known as Hybridization is defined as the spontaneous pairing occur of comple...

Q: n is forever. Do you agree or di

A:

Q: make a point mutation and Frameshift mutation

A: point mutation, change within a gene in which one base pair in the DNA sequence is altered. Point mu...

Q: How Web site, Webcutter are used for generating restriction maps ?

A: Constructing some long-range restriction maps are dependent on making the use of restriction enzymes...

Q: Mutations in the genes of an operon could affect the expression of its genes. For each statement, in...

A: Introduction: Mutation can be defined as any change in DNA. This is any heritable and genetic change...

Q: Define about Thermus aquaticus ?

A: Introduction Bacteria are common, largely free-living organisms that are often made up of only one b...

Q: In your own understanding, explain the function of mast cells.

A: Mast cells are immune cell that take part in variety of physiological responses. They are located in...

Q: When IkB is phosphorylated, NFKB is free to initiate gene expression promoting protein degradation. ...

A: A state of "physical fitness" can be defined as a condition of well-being. Bodily health is a genera...

Q: Effects of BPA on phosphorylation and translocation of NFκB and degradation of IκB in RAW264.7 cells...

A:

Q: How did population growth curve with LOW migration compare with the normal population growth curve? ...

A: Migration is movement of organism from one place to another. 

Q: In the hawk-dove game, at what value of c do doves and hawks have equal payoffs when hawks are extre...

A: Introduction: In game theory, the chicken game, also known as the hawk–dove game, is a model of conf...

Q: From the list given - choose all the regulatory sequences that you thỉnk would control the expressio...

A: Introduction Gene expression in eukaryotic cells is regulated by repressors as well as by transcript...

Q: This protein that is involve in immune system responses is measured to check to individuals who were...

A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...

Q: 1. Decoding mRNA into amino acids is called translation.

A: above given statements are about transcription, translation process and how amino acids makes a prot...

Q: What are the balanced chemical equations of breathing?

A: Breathing is the movement of air in and out of lungs, that is the organs where gas exchange between ...

Q: Which molecules can maintain the ordered structure of collagen fibrils in the cornea?

A: The collagen fibrils are made by the collegen fibres arranged compactly to give the fibrils like pat...

Q: What crop characteristics influence yield? Size of source (manufacture) and sink (storage and/or usa...

A: The most important factors affecting crop yield include:- Soil Fertility:- Tbe main criteria for gr...