Q: Describe the difference between a transcriptional fusion and a translational reporter gene fusion.…
A: Transcription fusion means cloning the promoter of interest, upstream of any transcription unit,…
Q: There is no information about the function of this gene. What would you do to obtain the cDNA for…
A: NOTE- Since you have asked a question that contains multiple parts So keeping a note as per our…
Q: Consider the following mRNA molecules and the amino acids they code for. The second mRNA molecule is…
A:
Q: Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases…
A: In eukaryotic organisms, the gene contains introns as well as exons. Eukaryotic genomes are much…
Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Translation is the process which is responsible for synthesis of protein from the mRNA.
Q: The insertion of transposable elements into genes can alter the normal pattern of expression. In the…
A: NOTE:- As you have posted multiple questions under one, we will solve the first part for you, to…
Q: What is the advantage and disadvantage of gene repression in development and What does it mean when…
A: Introduction Enhancers are small regulatory regions of accessible DNA that help in the establishment…
Q: True or False? LINE elements encode functional transposition protein and thus can move autonomously…
A: LINEs are widely distributed among eukaryotes. Approximately 21% of the genome is covered by LINEs…
Q: How would a mutation which prevented Gal3 from binding to Gal80 affect gene expression from the GAL…
A: Galactose metabolizing genes express themselves in the presence of galactose. Galactose is…
Q: The coding sequence for gene F is read from left to right on the accompanying figure. The coding…
A: DNA is the polymer of nucleotides.
Q: Which of the following incorrectly describes the difference between eukaryotic and prokaryotic gene…
A: Prokaryotic organisms are single-celled creatures that lack the cell nucleus, and their DNA…
Q: Expression of recombinant proteins in yeast is an important tool for biotechnology companies that…
A: Telomeres are the caps at the end of each strand of DNA that protect the chromosomes, like the…
Q: How does the control of gene expression in prokaryotes differ from that of eukaryotes
A: The gene expression the process in which the genetic information present in the DNA (gene) is copied…
Q: When wild-type E. coli are grown in media with high lactose and no glucose, which of the following…
A: The lactose operon (lac operon) is an operon required for the transport and metabolism of lactose in…
Q: Cells tend to have a relatively small and uniform size. Why aren’t cells larger? Discuss your…
A: Cell is the basic structural, functional and biological unit of all organisms.Cell is the smallest…
Q: Eukaryotes have a multitude of ways of regulating gene expression. Why are all these regulatory…
A: gene regulation is the process used to control the timing, location and amount in which genes are…
Q: Some eukaryotic mRNAs have an AU-rich element in the 3′ untranslated region. What would be the…
A: The 3’ UTR is the untranslated region in the mRNA that follows the termination codon of translation.…
Q: An integrated gene X inserted into the yeast genome near a telomere. Will this strategy result in…
A: Introduction Telomers are the farthest most ends of the chromosomes which contains the repeated…
Q: An enhancer, located upstream from a gene, has the following sequence: 5′–GTAG–3′ 3′–CATC–5′ This…
A: An enhancer is a short segment of Deoxy ribonucleic acid (DNA), which binds to activator proteins so…
Q: Which of the following statements about the attempt to express a eukaryotic gene in bacteria is…
A: The regulation of gene expression in eukaryotes occurs at several level, which is far more diverse…
Q: One mutation is a deletion of six nucleotides in the second exon of the gene and the other mutation…
A: Introns and exons are nucleotide sequences within a gene in mRNA. The conversion of DNA to RNA is…
Q: A mutation in the trp repressor gene that prevents the apo-repressor from binding the co-repressor…
A: Tryptophan operon Tryptophan operon is negatively regulated operon, it includes five gene, promotor,…
Q: he steps to replicate the identified spike protein are as follows: . Find the CDNA sequence of the…
A: Gene expression is a phenomenon in which gene is expressed into a particular protein. It is a very…
Q: Why is there some signal present within the ‘no sugar’ and other noninducing sugars for the green…
A: The arabinose promoter is a special type of DNA sequence that controls the expression of genes in…
Q: At which of the following level(s) can gene expression be regulated in eukaryotes?
A: Introduction Gene expression is the process through which information from a gene is used to create…
Q: What proportion (in %) of the CFTR gene/DNA sequence is represented in the CFTR mRNA? The mRNA…
A: The cystic fibrosis transmembrane conductance regulator (CFTR ) gene displays a tightly regulated…
Q: exact factors that can cause post translational modification of skeletal protiens what is its…
A: The "double-helical structure" of DNA is duplicated via a process called DNA replication. Then, the…
Q: A disease is caused by having no functional protein produced from the KIP gene. An individual has…
A: The gene expression follow the rules of central dogma that involves production of the final product…
Q: Based on Figure 9-19, can you predict the position of amutation that would affect the synthesis of…
A: Mutation Are changes in the sequence of DNA. It can occur as a result of DNA copying errors during…
Q: From the list given - choose all the regulatory sequences that you think would control the…
A: A regulatory sequence is a nucleic acid molecule segment that has the ability to increase or…
Q: From the list below, which would be true if you expressed a eukaryotic gene in a bacterial cell?…
A: The bacterial transcriptional machinery does not have post-transcriptional modifications like…
Q: A disease is caused by having no functional protein produced from the kip gene. An individual has…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete…
A: Transcription in eukaryotes occurs in three consequent stages that start with the initiation step,…
Q: A new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a…
A: A gene is a stretch of nucleotides present in the DNA. It codes for the synthesis of an RNA or…
Q: Does transcriptional reporter with GFP allow you to see the expression of the different isoforms?…
A: Alternative splicing (AS) plays a fundamental role in the diversification of protein function and…
Q: Yes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in…
A: Rna seq can provide sequence and expression data : YES Single-cell RNA sequencing (scRNA-Seq)…
Q: Your research project involves adding a salamander gene to a bacterial cell so that it gets…
A: Recombinant DNA technology or RDT is a biotechnological technique that is used to take a gene of…
Q: Is it possible to induce the protein expression of a yeast gene from a prokaryotic expression vector…
A: Yes this is possible... First we isolate the yeast species which are needed for protein expression.…
Q: Genome-wide RNAi screens target expression of > 16,000 genes. Explain how each of these 16,000+…
A: The control of gene expression in a cell to inhibit the expression of a specific gene is known as…
Q: How can methylation affect transcription? a. It may prevent the binding of regulatory transcription…
A: Introduction: DNA methylation, an epigenetic characteristic in eukaryotic organisms, is a process by…
Q: What would be the most likely result of injecting bicoid mRNA into the posterior end of a Drosophila…
A: Various different genes regulate the formation of dorsal-ventral surface and anterior-posterior…
Q: ou want to clone the yeast ABC gene into an expression vector. Is it possible to induce the rotein…
A: Transgenic organisms are the organisms which contain a foreign DNA. While cloning eukaryotic genes…
Q: You want to clone a eukaryotic gene and express the corresponding protein in yeast. However, the…
A: Most eukaryotic genes contain segments of coding sequences (exons) interrupted by noncoding…
Q: What role does an operator sequence serve in bacterial gene expression regulation? Describe one…
A: As per the honour code, we are entitled to do only one question at a time. So, I am providing the…
Q: How would the removal of the TATA box in a eukaryotic gene impact transcription? Group of answer…
A: A gene is the stretch of DNA that codes for a polypeptide.
Q: Mutations that occur in enhancer sequences would most likely affect the cell by ____. altering…
A: Transcription is a process by which the RNA is transcribed from the DNA sequence using RNA…
Q: In the laboratory, you want to study protein that is normally toxic to E. coli cells. You wish to…
A: AraBAD promotor is a structural gene of L-arabinose operon in E.coli. AraBAD basically are 3…
Q: The human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription…
A: Throughout an organism's life, the original DNA (deoxyribonucleic acid) molecule in the nucleus acts…
Q: Expression of recombinant proteins in yeast is an important tool for biotechnology companies that…
A: The production of recombinant protein is very costly. For the process of development of any new…
Telomere position effect (TPE) alters the gene expression in yeast cells? why?
Step by step
Solved in 2 steps
- The MAT locus allows yeast to switch mating type through a very complex mechanism. However, it has informed us a great deal about what aspects of gene expression typical to all organisms? Options: higher order changes in chromatin affect transcriptional efficiency that general transcription factors must first bind directly to histone tails and only then can they interact with their cognate binding sites that DNA methylation is involved in this silencing mechanism that SIR2 is required for all types of transcriptional repression that expression of Pol III genes provides a means of identifying active chromatinBelow is a schematic diagram showing a 3000 bp region of yeast genomic DNA. TSS 5' 3' 5' +1 (i) Draw and name specific regions in this schematic diagram that can be recognized by Transcription factor IID (TFIID). (ii) How does Transcription factor IIH (TFIIH) initiate the transcription? in inSearching the yeast Saccharomyces cerevisiae genome, researchers found approximately 4,000 DNA sites with a sequence which could potentially bind the yeast transcription factor GAL4. GAL4 activates the transcription of galactose genes. Yet there are only 10 GAL4-binding sites which control the genes necessary for galactose metabolism. The GAL4 binding sequence is CGGAT#AGAAGC*GCCG, where # is T, C or G, and * is C or T. In one chromatin immunoprecipitation experiment (ChIP), yeast growing on galactose were lysed, and subjected to cross-linking reagents which cross-linked transcription factors and activators to DNA. Next the DNA was sheared into small fragments, and antibodies to GAL4 were added. These antibodies coprecipitated the GAL4 and the DNA it was cross-linked to. The cross-linking was then chemically reversed, and the DNA was isolated, cloned into a library of plasmids and sequenced. Results showed that only 10 different DNA sequences had GAL4 bound. Since the…
- You are working on a protein for a research project. The protein does not express well in prokaryotic expression systems so you decide to try a eukaryotic system, baker’s yeast, instead. As part of the expression system, you add a signal peptide to the protein so that it will be exported through the endomembrane system to the outside of the yeast cell. This makes purifying the protein much simpler. During the purification, you notice that the protein is heavier than it should be during gel filtration chromatography. This is confirmed by SDS-PAGE. What could be the reason that the protein has gained mass when expressed in the eukaryotic system?The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?Expression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? please try to explain a bit elaborately.
- The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAplease explain if it would be elongated or shortened expression! I know double mutant epistasis is always downstream> upstream but if upstream gene controls downstream, what happens?
- Methylation of H3K9 by itself silences genes, but if H3K4 and H4K20 are also methylated, the combination of modifications stimulates transcription. What conclusions can you draw about this?Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'What effect would inhibitors of histone deacetylases have upon transcription? Group of answer choices They would increase transcription by making the chromatin more compact They would increase transcription by making the chromatin less compact They would decrease transcription by making the chromatin more compact They would decrease transcription by making the chromatin less compact For this question, we will consider a eukaryotic mRNA that has four exons (E1, E2, E3, E4) and three introns (I1, I2, I3). What could occur if a protein were to bind over the 3' splice site of intron 2 (I2)? Group of answer choices The processed mRNA would consist of: E1+E2+E3+E4 The processed mRNA would consist only of: E1+E3 The processed mRNA would consist only of: E3+E4 The processed mRNA would consist of: E1+E2+E4