Q: 11. Here is a short stretch of replicating DNA. The top strand is the template. Assume the 4.... are…
A: In the multipart question, we are allowed to answer only 1st three subparts. Kindly repost the…
Q: what difficulty will you experience if you do genetic manipulation to streptomyces spp. and how can…
A: Streptomyces spp produces mainly actinomycins (for example streptomycin), tetracyclines,…
Q: Review transcription. Match the term and its description. Each term can only be used once. RNA…
A: RNa synthesis is catalyzed by the enzyme - RNA polymerase The DNA sequence where RNA polymerase…
Q: Q6) Why are ‘sticky ends’ useful biotechnologically? Q7) Why is this enzyme called a restriction…
A: When restriction enzymes cut between two bases on the same strand at one end of the sequence and two…
Q: Synthesize a Protein 5. Below is a region of a gene. Transcribe the gene into a pre-mRNA strand. DNA…
A: In this question, we have to answer the mRNA sequence , processing of mature RNA and peptide chain…
Q: A terminator loop is… Group of answer choices a. A tertiary structure in DNA that causes DNA…
A: Introduction :- There are three main steps , that are present in any molecular events , like - in…
Q: For each of the following items, describe what it is explain the necessity for each in cloning…
A: Genetic engineering is the application of technology in the manipulation of genetic information.…
Q: 8. Which reporter construct design would be best for moni IGFP green when, and how much a…
A: The promoter is the upstream region of the gene which enables the identification of the gene to be…
Q: econstruct the corresponding DNA template sequence from the partial mRNA sequence…
A: It is a double-stranded molecule made of nucleotides which are made from a nitrogenous/ organic…
Q: try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding…
A: The central dogma of molecular biology involves transportion and translation. the transgression is…
Q: intron-Seauence of nueleotides klith in the gene but are r emeved fürm the Ŝeaçuente a final MKNA…
A: Ribonucleic acid (RNA) modifications refers to alteration in the chemical composition of ribonucleic…
Q: 3. Using the double stranded bacterial sequence provided below: ( - Indicate the promoter sequence…
A: All description given in this question though in brief transcription is a process where RNA produce…
Q: es or no? during situ hybridization digoxygenin can be recognized by antibody. Does pcr…
A: The polymerase chain reaction (PCR) is an effective method for amplifying nucleic acids (DNA or RNA)…
Q: Yes or no? does rNTP's need to synthesize dsRMA? does rna seq allow to detect of splice…
A: rNTP is ribonucleoside triphosphate which is composed of a ribose sugar, 3 phosphate groups attached…
Q: Transcribe and translate the following DNA sequence (nontemplate strand);…
A: The gene is expressed into protein by the transcription and translation step.
Q: Yeast artificial chromosome how the synthesised?
A: Yeast artificial chromosome (YAC) is a human-engineered DNA molecule used to clone DNA sequences in…
Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…
A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…
Q: 11) Draw a bacterial expression vector with all required vector sequences. Be sure to label any…
A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to…
Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short…
A: The transcription is the process by which RNA is produced from the DNA template and the translation…
Q: MAKE CONNECTIONS Compare the CRISPR-Cas systemto the miRNA system discussed in Concept 18.3,…
A: CRISPR proteins form an enzyme called Cas9 enzyme the function of which is on recognizing the target…
Q: VISUAL SKILLS If the DNA pol I in a given cell werenonfunctional, how would that affect the…
A: An RNA primer initiates the synthesis of the leading strand and this should be removed and replaced…
Q: VISUAL SKILLS Describe what happens to the trp operon as the cell usesup its store of tryptophan
A: An operon is a group of genes and the promoter, including some more regulatory sequences. These…
Q: Remodeling complexes use the energy from ATPhydrolysis to change the position of…
A: Chromatin remodeling is the structural modification of chromatin to allow access of condensed…
Q: BIOLOGY 123, SPRING 2022 LAB STUD Q13. Using examples, explain why the genetic code is considered…
A: Q. Using examples, explain why the genetic code is considered redundant but not ambiguous.
Q: Pre-mRNA processing takes place in
A: EXPLANATION In bacteria, transcripts RNA are ready to function as messenger RNAs and translated into…
Q: asap please A partially filled diagram of eukaryotic gene structure is shown below. Label the…
A: A typical eukaryotic gene is made up of exons (sequences that appear in mature mRNA) and introns…
Q: Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'…
A: Given information: The sequence of mRNA is as follows: 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3'
Q: ZFNs What is it? And how it works in genome editing?
A: Zinc-finger nucleases are counterfeit limitation catalysts (artificial restriction enzyme) produced…
Q: Bob's telomerase works extremely well (10x better than the average humans). Explain the function of…
A: Telomerase is an enzyme. It maintains length of telomere by adding repetative sequence that are…
Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers 6. What are…
A: We are authorized to answer one question at a time since you have not mentioned which question you…
Q: transduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial…
A: The three methods or mechanisms of gene transfer in bacteria are: Transformation, Conjugation, and…
Q: Draw 4 total cycles of the thermal cycler. Begin with one original strand of DNA and show/explain…
A: *Thermal cycler is an laboratory apparatus used to amplify DNA segments through the polymerase chain…
Q: r it 6- Complete the following: a) Two fragments of DNA can be joined by a b) Restriction enzymes…
A: Recombinant DNA technology is the process by which we can isolate our gene of interest and then…
Q: Question: how does the flu without the track arise and what does it mean male type splicing if the…
A: Flu first arrise from birds and animals then it transmitted into humans. It's spread from virus.…
Q: 5d. Remembering that hexose metabolism is a highly conserved process among all branches of life, how…
A: Hexose operon should contain 10 genes.
Q: Saration plasmids? 9. Predict and explain the effect of each of the following conditions on the Tm…
A: The Tm value is defined as the temperature at which half of the ds DNA is denatured . a) Now at pH…
Q: Nutritional requirements of white verses red yeast What is the differences in the ability of…
A: Yeasts are a type of fungi. Normal or wild-type yeast colonies are usually white in color. This…
Q: MAKE CONNECTIONS Although the proteins that cause theE. coli chromosome to coil are not histones,…
A: The chromosomes are the densely packed DNA molecules that are found within the cells. The DNA is the…
Q: Explain briefly how bacteriophages causes mutation .
A: Bacteriophages (phages) are the most numerous organisms on the planet, yet very little learned…
Q: 12. You are working with a picce of DNA of the sequence: 5'-TATTGAGCTCCCCGGAT-3…
A: Restriction enzymes cut DNA at a specific location called as restriction site.
Q: Fill in the gaps? One major goal/motivation in the development of synthetic genomes is ...... .…
A: In some ways, synthetic biology is similar to genome editing as both involve changes in the genetic…
Q: 13. In your own words, identify one of the reasons why it is difficult to assemble a genome and…
A:
Q: Reset Help defined as changes in the sequence of Mutations DNA frameshift mutations caused by…
A: a- mutagens (mutations caused by environmental factors) d- carcinogens (mutagens include cancer…
Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…
A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…
Q: MAKE CONNECTIONS Speculate about whether thesame enzyme could methylate both a histone and a…
A: Epigenetics is defined as the heritable and non-heritable changes that take place in the gene…
Q: DNA ISOLATION IN FRUITS 1. How do you minimize the interaction between DNA and histones in the…
A: Introduction: The nucleosome complex of DNA folded over a histone protein octamer sorts out the…
Q: MIRNA (Ca he 'seed region').. 3: what actually happened if Splicing factor mutated? Give an example…
A: In spliceosomes during post transcriptional modification introns are removed from the m RNA which…
Q: WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is…
A: The deoxyribonucleic acid (DNA) is the hereditary material that transmits the genetic information…
Q: 11) Draw a bacterial expression vector with all require vector sequences. Be sure to label any…
A: Bacterial expression vectors are used to introduce foreign genetic material into a host in order to…
Q: TALENs What is it? And how it works in genome editing? Including
A:
MAKE CONNECTIONS The restriction site for an enzyme
called PvuI is the following sequence:
5’-CGATCG-3’
3’-GCTAGC-5’
Step by step
Solved in 2 steps
- pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:Which feature of promoters can be found in both prokaryotes and eukaryotes? GC box TATA box octamer box -10 and -35 sequences
- Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAIn the following gel showing stained bands of the Alu insertion sequence, what is the genotype of individual 2? 941 bp 641 bp->>> 1 2 3 4 5 6 Homozygous for the 641 bp sequence that does not contain in the Alu insertion Heterozygous, containing one 941 bp sequence and one 641 bp sequence O Homozygous for the 941 bp sequence containing the Alu insertion
- Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'Q1. Transcribe and Translate the following DNA.Be sure to label which sequence is your transcript and which is your translated product. Be sure to label all 5' and 3' and NH3 and COOH terminals. Transcriptional start site is highlighted Coding 5’CCTGACGATGCACAAACCATATTAGAA 3’ Template 3’GGACTGCTACGTGTTTGGTATAATCTT 5’ Open ReadingFrame ProteinCynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
- Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…Transforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
