7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a different way you can determine reading frame. a. The following sequences of orthologous copies of the insulin receptor gene (INSR) from four species. The sequences are aligned but the reading frame is unknown. What is the reading frame for these sequences? (ie., Does the first complete codon begin at the first, second, or third nucleotide?) Hint: Think about what you know about the nature of mutations, natural selection and the genetic code. 1. Bear CCTGAAGAGCTACCTCCG CTCCCTG C G G C C G GAGGCTGAGAATAACCCC GG CCGCCCT CCTGAAGAGCTACCTCCGTTCTCTGCGGCCAGAGGCTGAGAATAATCCTG GCC G C CCT 2. Human 3. Chicken 4. Cow CTTGAAAAGCTACCTACGCTCTCTGAGACCCGACGCTGAGAATAACCCTGGTCGTCCA CCTGAAGAGTTACCTCCGTTCCCTG C G G CCT GAGGCTGAGAATAACCCCG GCC GCCCT

Q: HOTS 21 Which food is more nutritious-cornflakes milk, or plain noodles?

A: Food includes the substances that we eat to obtain nutrients.

Q: A  B C D1 Forest floor refers to the growth that is found directly on the ground in the forest. This…

A:

Q: Which statement is true? Explain your answer.   A. Natural selection acts on populations, not on…

A: Introduction Natural selection is an evolutionary process by which the organisms that can adapt to…

Q: 1 Given the events of the cell cycle shown above, where would you predict there might be checkpoints…

A: Cell division is the process through which two daughter/new cells are produced from a parent cell.…

Q: Describe each compound of bacterial vaccines:   -inactivated proteinaceous toxoids (toxoids)…

A: Several procedures are used to create vaccines. They may comprise rendered sterile or dead bacteria,…

Q: Allied Corp.. a food processing company, wants to achieve competitive advantage by sustainable…

A: An ecosystem is essential because it conveys one of the key insights we have gained from ecology…

Q: 11:04 patients would recover more quickly than those who did not take the antibiotic. The…

A: Introduction  Antibiotics, commonly referred to as antibiotics, are drugs that stop or inhibit the…

Q: In the fungus Neurospora, a strain that is auxotrophic for thiamine (mutant allele t) was crossed…

A: Neurospora is an Ascomycete fungus genus. The genus name, which means "nerve spore," refers to the…

Q: The diagram shows one possible evolutionary history based on genetic sequences from Schmidt's…

A: Introduction A phylogenetic tree is a tree-like representation that depicts the relationships…

Q: Instruction: Go outside and observe your surroundings. From your observation, formulate a hypothesis…

A: INTRODUCTION Green plants and other certain autotrophic organisms synthesize their own food material…

Q: What is reproductive in Honey bee

A: Offspring are produced during reproduction.  Sexual and asexual reproduction are the two main types.…

Q: _____ tissues are sheetlike with one free surface. a. Epithelial c. Nervous b. Muscle d. Connective

A: Tissues are the group of cells that are determined to carry out a specific function. These are of…

Q: aerobic better for steady state and anaerobic better for burst

A:

Q: 1. What were the clues that led to the identification of the suspect? 2. What do you think the…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Which of the following is based on the interactions of species with their abiotic environment?a.…

A: Introduction An ecosystem deals with both biotic and abiotic factors and their interaction with each…

Q: What does RNA polymerase transcribe from the Lac Y gene on the lac operon? O beta-galactosidase O…

A: Lac Operon is a set of genes that are transcribed by the RNA polymerase which are solely responsible…

Q: In peas, round (R) is dominant to wrinkled. (r )You cross a round pea plant to a wrinkled pea plant…

A: Gregar Johann Mendel, was an Austrian monk, who studied at Vienna University. He worked with me due…

Q: Glyphosate is an herbicide used to kill weeds. It is the main component of a product made by the…

A: Glyphosate is a broad-spectrum herbicide used to control weeds in food and nonfood field crops such…

Q: Someone in your social circle is a hard-core gluten-free advocate, to the point where they dictate…

A: Gluten-free diets are all the rage these days, with more and more people eliminating gluten from…

Q: Describe the reason behind the occurrence of phage growth and release by the mating with the…

A: Bacteriophages frequently transition between the lytic and lysogenic states. The two gene regulatory…

Q: Why is edema present in individuals with nephrotic syndrome?

A: Introduction  Pressure plays an important role in sustaining the normal physiology of the body.…

Q: Under genetic drift, if an allele’s frequency is 1%, what is the likelihood that it will be lost…

A: Genetic Drift is also called as an allele drift. It is the change in allele frequency by chance.…

Q: how biotechnology evolved from ancient biotechnology, classical biotechnology, and modern…

A: Biotechnology is the use of biological systems found in organisms or the use of the living organisms…

Q: Use the sequence alignment tool Smith and Waterman for the amino acid number 16-30 of the protein…

A: The Smith-Waterman algorithm uses local sequence alignment to find similar regions between two…

Q: Bob is a 19-year old male, who is 6’3”, and weights 160lbs. You tested Bob’s 1.5-mile run time, and…

A: The amount of oxygen you breathe in litres per minute is your absolute VO2 max. This quantity relies…

Q: Compare the mechanism of genetic recombination in linked and unlinked genes

A: Genes are the stretch of DNA that code for a polypeptide.

Q: Describe the process involved in the aquatic carbon cycle

A: A group of environmental activities that involve the incorporation of carbon dioxide into living…

Q: How does breast development differ between adult men and women?

A: Introduction Humans belongs to class Mammalia. Means they have mammary glands to feed their young…

Q: What is an organism that spreads disease germs to humans after biting and infected organism causes…

A: The diseases is a condition where the body reacts abnormally. Several ticks, flies, mosquitoes,…

Q: Make a brief summary of each of the stages of bacterial growth.

A: Bacterial growth occurs orderly in which the cellular constituents as well as the number of…

Q: The glycolysis pathway is an example of: (choose one) a) aerobic catabolism. b) anaerobic…

A: Cellular respiration is the pathway by which nutrients are oxidized in presence of oxygen.

Q: Is the original strain of covid still in the world

A: The outbreak of COVID-19 pandemic has resulted in a lot of speculation about the origin of the virus…

Q: Discuss two alternative agricultural practices that are environmentally friendly.

A: Introduction Sustainable agricultural practices are the techniques in which there is the most…

Q: population, and the number of mating events for both islands. Graph 2: Number of Iguana Mating…

A: Marine iguana usually have no inter-specific as well as intra-specific competition for the food.…

Q: Why is prompt treatment of pelvic inflammatory disease (PID) critical to reproductive health?

A: Introduction Pelvic inflammatory diseases are the diseases caused in the upper reproductive organs.…

Q: Which of the following should not be considered when designing nature reserves?a. edge effects that…

A: A nature reserve is a biological reserve created to preserve wildlife, plants, and animals as well…

Q: Write the major rules for the binomial nomenclature. Why they are needed?

A: The rules for binomial nomenclature are framed and standardized by some international scientific…

Q: Explain how mutations in the following proteins might result in either loss of responsiveness to a…

A: Introduction Mutation is a sudden heritable change in our genome or genetic material. Mutation can…

Q: Which of the following is NOT a consequence of the shift to an agricultural way of life?

A: Introduction Agriculture is the practice of cultivating the land to grow crops and obtain food,…

Q: Explain the consequences; a. if simple columnar epithelium replaced non-keratinized stratified…

A: Epithelium:- it is a type of body tissue that usually coverup the internal as well as external…

Q: Architect Louis Henri Sullivan coined the phrase, “Form ever follows function.” What do you think he…

A: Louis Henri Sullivan is an American architect also known as the father of skyscrapers and the father…

Q: Compare/Contrast Benefits and Costs of Aerobic vs Anaerobic metabolic pathways for endothermic and…

A:

Q: What role does biodiversity play in the energy flow of ecosystems?

A: Ecosystems sustain themselves by recycling nutrients and energy from outside sources, such as the…

Q: Explain the following areas about (Ventilator) 1. What are the ingredients the device? 2. Working…

A: Introduction Ventilators are machines that are used to bring oxygen to the lungs by pressurising…

Q: There are two hypotheses to explain the pattern of Human Evolution: 1) Progressive Evolution of a…

A: Since we are so complicated, no one field can truly "understand" us. So, let's examine some of the…

Q: 1. A bacterium that does not have all the enzymes of central metabolism: a. Will not be a viable…

A: Bacteria are common, single-celled, free-living creatures. They are prokaryotic microbes. Bacteria…

Q: Explain the following areas about scan)) ((Computed tomography..CT 1. What are the ingredients the…

A: ANSWER) CT scan is a machines used for diagnosis processes in the field of medical sciences, it is a…

Q: give example for food record/diary of weighed quantities of food consumed by an individual for 4 day

A: Weighed food diaries, often known as diet diaries or food records, are prospective dietary…

Q: Briefly describe the causes of anemia, cardiovascular disease, and bone and neurologic changes…

A: Introduction Kidneys are very important part of our body. They are not just associated with urine…

Q: How do plants use small organic molecules to grow bigger

A: Plants are known as primary producers because they produce their own food. They are able to produce…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.