Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 6P
Agarose gels with different average pore sizes are needed to separate DNA molecules of different size classes. For example, optimal separation of 1100 bp and 1200 bp fragments would require a gel with a smaller average pore size than optimal separation of 8500 bp and 8600 bp fragments. How do you think that scientists prepare gels of different average pore sizes? (Hint: Agarose gels are made in a manner similar to gelatin desserts such as JELL-O.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane.
What if you had two different DNA fragments that were exactly the same length as measured in base-pairs. Would it be possible to distinguish them using this type of electrophoresis? How would they appear on a gel?
You're purifying some plasmid DNA from a culture of bacteria and you want to know how pure it is.
You measure the optical density at 260 nm and 280 nm and find the ratio is 2.0. You suspect there is RNA contamination in your preparation, so you treat your preparation with RNase. But the ratio is still 2.0. Protein assays tell you there is no protein in your solution, and no other biological molecules absorb light very efficiently at those wavelengths. What's the explanation?
Both protein and DNA are run together in an isoelectric focusing (IEF) electrophoresis using the immobilised pH gradient (IPG) strip with pH range of 4-7. After the electrophoresis and staining, only ONE band is observed on the middle of the IPG strip. The band is a protein band. Briefly explain why only the protein band and NOT the DNA band appear on the IPG strip.
Chapter 9 Solutions
Genetics: From Genes to Genomes
Ch. 9 - Match each of the terms in the left column to the...Ch. 9 - For each of the restriction enzymes listed below:...Ch. 9 - The calculations of the average restriction...Ch. 9 - The DNA molecule whose entire sequence follows is...Ch. 9 - Why do longer DNA molecules move more slowly than...Ch. 9 - Agarose gels with different average pore sizes are...Ch. 9 - The following picture shows the ethidium...Ch. 9 - The linear bacteriophage genomic DNA has at each...Ch. 9 - Consider a partial restriction digestion, in which...Ch. 9 - The text stated that molecular biologists have...
Ch. 9 - a. What is the purpose of molecular cloning? b....Ch. 9 - a. DNA polymerase b. RNA polymerase c. A...Ch. 9 - Is it possible that two different restriction...Ch. 9 - A plasmid vector pBS281 is cleaved by the enzyme...Ch. 9 - A recombinant DNA molecule is constructed using a...Ch. 9 - Suppose you are using a plasmid cloning vector...Ch. 9 - Prob. 17PCh. 9 - The lacZ gene from E. coli encodes the enzyme...Ch. 9 - Your undergraduate research advisor has assigned...Ch. 9 - Which of the enzymes from the following list would...Ch. 9 - You use the primer 5 GCCTCGAATCGGGTACC 3 to...Ch. 9 - a. To make a genomic library useful for sequencing...Ch. 9 - Problem 15 showed part of the sequence of the...Ch. 9 - Eukaryotic genomes are replete with repetitive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardThe sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forward
- Agarose gels with different average pore sizes areneeded to separate DNA molecules of different sizeclasses. For example, optimal separation of 1100 bpand 1200 bp fragments would require a gel with alarger average pore size than optimal separation of8500 bp and 8600 bp fragments. How do you thinkthat scientists prepare gels of different average poresizes? (Hint: Agarose gels are made in a mannersimilar to gelatin desserts such as JELL-O.)arrow_forwardYou have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atmarrow_forwardQuantification of DNA can be done by using a Nanodrop, a UV spectrophotometer, by measuring its absorbance in units of optical density (OD) (see “Nanodrop Microvolume Quantitation of Nucleic Acids" video in Lab 3 on Laulima). DNA absorbs light most strongly at the ultraviolet wavelength of 260 nm. The absorbance of double stranded DNA (dsDNA) at 260 nm (A260) is used to estimate concentration, with 1.0 OD equal to a dsDNA concentration of 50 µg/ml. Using this information we can calculate the concentration of dsDNA in our extractions using the following formula: dsDNA concentration = 50 µg/ml x OD260 x dilution factor Using the formula provided above, calculate the concentration of dsDNA in an extraction that was diluted 20X and had an A260 reading of 0.64 OD. Show your workarrow_forward
- Which well(A through E) of this agarose gel contains the smallest DNA size? Please look at the pic.arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forwardPut the following pieces of DNA in order that they would appear reading from the top (nearest the loading point) to the bottom of a gel, with "first" meaning nearest the top. First [ Choqse [Choose] 21,000 basepairs (bp) Second 10,000 bp 23 kilobases (kB) 18 kB 2,300 bp Third [Choose ] Fourth [ Choose] [Choose] Fifth > >arrow_forward
- A solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.arrow_forwardWhen proteins are separated using native gel electrophoresis, size, shape, and charge control their rate of migration on the gel. Why does DNA separate based on size, and why do we not worry much about shape or charge?arrow_forwardThe DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License