Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 23P
| a. | To make a genomic library useful for sequencing an entire genome, why would you ordinarily fragment the genomic DNA by mechanical shearing forces like sonication rather than by cutting the DNA with a restriction enzyme? |
| b. | Suppose that you wanted to make a genomic library to determine the complete sequence of a newly discovered organism’s genome, but you did not have a sonicator readily available. Explain how you could nonetheless use two or more restriction enzymes to make libraries whose clones could be sequenced so that a computer could assemble the genomic sequence. |
| c. | Suppose you only had a single restriction enzyme available, and you want to make a single genomic library from which you could assemble the genomic sequence. How might you be able to achieve this goal? (Hint: See Problem 9.) To make this library, would it be preferable to use a restriction enzyme that recognizes a 4-base, 6-base, or 8-base sequence of DNA? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are trying to clone a gene. You have successfully isolated it from the genomic DNA of an organism using
the Hindlll restriction enzyme. You then take a plasmid with a single EcoRI restriction site and cleave it with
EcoRI. You combine these two fragments and treat them with DNA ligase. Answer the two questions below.
a.(2 points Does the cloning reaction succeed as described? If so, what is the product obtained?
b.
Explain your answer above.
On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img)
i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples?
ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
A more modern molecular technique to RFLP fingerprinting is called Amplified Fragment Length Polymorphisms (AFLPs). In AFLP analysis, restriction enzymes are again used to digest genomic DNA into multiple fragments. Next, adapters complementary to restriction site overhangs are ligated to the fragments using an enzyme called DNA ligase. These adapters are complementary to primers used to amplify the fragments using the polymerase chain reaction (PCR). Can you think of any potential benefits of AFLP analysis over RFLP? Explain your reasoning.
Chapter 9 Solutions
Genetics: From Genes to Genomes
Ch. 9 - Match each of the terms in the left column to the...Ch. 9 - For each of the restriction enzymes listed below:...Ch. 9 - The calculations of the average restriction...Ch. 9 - The DNA molecule whose entire sequence follows is...Ch. 9 - Why do longer DNA molecules move more slowly than...Ch. 9 - Agarose gels with different average pore sizes are...Ch. 9 - The following picture shows the ethidium...Ch. 9 - The linear bacteriophage genomic DNA has at each...Ch. 9 - Consider a partial restriction digestion, in which...Ch. 9 - The text stated that molecular biologists have...
Ch. 9 - a. What is the purpose of molecular cloning? b....Ch. 9 - a. DNA polymerase b. RNA polymerase c. A...Ch. 9 - Is it possible that two different restriction...Ch. 9 - A plasmid vector pBS281 is cleaved by the enzyme...Ch. 9 - A recombinant DNA molecule is constructed using a...Ch. 9 - Suppose you are using a plasmid cloning vector...Ch. 9 - Prob. 17PCh. 9 - The lacZ gene from E. coli encodes the enzyme...Ch. 9 - Your undergraduate research advisor has assigned...Ch. 9 - Which of the enzymes from the following list would...Ch. 9 - You use the primer 5 GCCTCGAATCGGGTACC 3 to...Ch. 9 - a. To make a genomic library useful for sequencing...Ch. 9 - Problem 15 showed part of the sequence of the...Ch. 9 - Eukaryotic genomes are replete with repetitive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank linearrow_forwardA. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the plasmid with Xhol and Xbal, which lane of the agarose gel represents the DNA fragments you would expect from the digestion? B. If you now decide to cut the plasmid with EcoRI, how many fragments will be produced and what will their sizes be? C. When running DNA samples on agarose gel, an electric field is applied. Towards which electrode will the DNA migrate and why?arrow_forwardThe figure below shows the recognition sequences and cleavage positions of three restriction enzymes.You plan to ligate DNA from two different sources. The target DNA is digested with BamHI,and the insert DNA is digested with BglII, and the resulting fragments mixed and incubatedwith DNA ligase. a) Write out the sequence (in double-stranded format) of the longest insert fragment that will result after BglII digestion, ensure the nature of the overhangs is clear.b) Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. c) Assume the ligation reaction was successful and you have generated a recombinant DNAmolecule. Which of the three enzymes listed above can be used to excise the insert DNAfrom the target? Motivate your answer.arrow_forward
- (i) Which of the DNA sequences shown below can be cut by using restriction enzyme? Explain your answer by analysing the sequences. Sequence A: 5'-AATGGCTGCCGTGGCTTA-3' Sequence B: 5'-TAACCCTGCGCATTTGCA-3' (ii) Given a DNA sequence, 5'-TACGAATTCGTAA-3' and EcoRI cutting site as below. Write out the double stranded fragments that are generated when EcoRI works on this DNA sequence. EcoR I 5.. GAATTC...3' 3...CTTAAG...5'arrow_forwardExplain why DNA ladders are usually included during gel electrophoresis. One aspect of PCR that can be modified is the annealing temperature. In general, higher annealing temperatures show more specificity towards a single template, whereas lower annealing temperatures show less specificity and may bind to multiple regions throughout the genome. Discuss how using an annealing temperature that is too high or too low might influence the results of a PCR assay (and gel electrophoresis results) such as the one used in this study.arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- a To make a genomic library useful for sequencingan entire genome, why would you ordinarily fragment the genomic DNA by mechanical shearingforces like sonication rather than by cutting theDNA with a restriction enzyme?b. Suppose that you wanted to make a genomic library to determine the complete sequence of anewly discovered organism’s genome, but you didnot have a sonicator readily available. Explain howyou could nonetheless use two or more restrictionenzymes to make libraries whose clones could besequenced so that a computer could assemble thegenomic sequence.c. Suppose you only had a single restriction enzymeavailable, and you want to make a single genomiclibrary from which you could assemble the genomic sequence. How might you be able to achievethis goal? (Hint: See Problem 9.) To make this library, would it be preferable to use a restriction enzyme that recognizes a 4-base, 6-base, or 8-basesequence of DNA?arrow_forwardYou are trying to clone a gene, You have successfully isolated it from the genomic DNA of an organism using the Hindill restriction enzyme. You then take a plasmid with a single EcoRI restriction site and cleave it with EcoRI. You combine these two fragments and treat them with DNA ligase. Answer the two questions below. a. Does the cloning reaction succeed as described? If so, what is the product obtained? b. Explain your answer above,arrow_forwardA restriction map lists the locations of DNA sequences that are cut by a particular restriction enzyme for a piece of DNA, such as a chromosome or a plasmid. Restriction maps are important when generating a construct for experimental use. Digesting the DNA sequence with the restriction enzymes will result in fragmented DNA of predictable sizes, based on the restriction map, that allow a researcher to analyze if his or her construct was generated correctly when visualized using gel electrophoresis. Use the linear restriction map to predict where bands would be expected on a gel if a digest is performed using the specified restriction enzymes. Assume that there is enough restriction enzyme that every possible restriction site on each molecule of DNA will be cut.arrow_forward
- Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.arrow_forwardRestriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translatearrow_forwardRefer to the succeeding diagram of two DNA samples (A, B) with the specific restriction enzyme(RE) recognition sites marked with arrows. A spontaneous mutation (insertion) occurred in DNAsample A and introduced an additional restriction site. 1. Design two (2) DNA probes to be used in RFLP analysis involving these two DNA samples.Draw/illustrate the region(s) in the DNA molecule which you will use as reference(homologous) sequences in the design of the probes, THAT -a. Will reveal RFLP polymorphism between the DNA samples after probedetection/visualization; andb. Will not reveal RFLP polymorphism between the DNA samplesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License