Concept explainers
To review:
The mRNA codon AUG is used as the start codon by organisms of all three domains of life.
a. The organisms of all three domains use the same amino acid as the initial amino acid in translation is to be checked and explained. Similarities and differences are to be identified.
b. Even though AUG being the most common start codon sequence, very less proteins have methionine as the first amino acid. Explain with reason.
Introduction:
Start codon of mRNA refers to the first codon of mRNA transcript that initiates the translation process. The start codon is AUG. It codes for methionine. Methionine is one of the amino acid that is encoded by a single codon in the genetic code. Not all proteins start with methionine, the second start codon is the modified form of methionine known as fMet. In prokaryotes, the initiation codon is fMet- formyl methionine. During the process of translation, tRNA molecule specifically recognizes the start codon with the help of initiation factors.
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- What is the sequence of the mRNA molecule synthesized from the DNA template strand 5'-TAACGGTACGAT-3'? Enter the mRNA sequence using the one-letter abbreviations for the nucleotides. 5'- UAACGGUACGAU What amino acid sequence is encoded by the mRNA molecule 5'-AACGGAUCACUAACCUAC-3'? Assume that the reading frame starts at the 5′ end. Use a codon table to determine the identity of the translated peptide. Enter the amino acid sequence using three-letter abbreviations for the amino acids separated by hyphens (-). N-terminus Asn-Gly-ser-Leu-Thr-Tyr What is the sequence of the polypeptide formed if poly(UUAC) is added to a cell-free, protein-synthesizing system? poly(His-Ser-Phe-Ile) Asn-Glu-stop poly(Leu) Val-Ser-Lys-stop poly(Tyr) -3' poly(Leu-Leu-Thr-Tyr) C-terminusarrow_forwardConsider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?arrow_forwardConsider the following wild-type double-stranded DNA sequence: 5' TATGAA AGT3 non-transcribed strand (sense strand) 5' 3' ATACTTTCA transcribed strand In the space below, write ONE of the possible DNA sequences of the transcribed strand shown above that results from BOTH a single substitution mutation of the first codon following the start codon that would also cause a nonsense mutation. Use the mRNA codon chart in the Appendix of your manual to help you. Answer: Checkarrow_forward
- What kind of bond is created between successive amino acids in a protein? If there are more codon combinations than amino acids available in biology, then why aren't amino acids encoded by two nucleotides for each codon instead of three? How does secondary and tertiary protein structure develop from the primary structure created during translation? The picture below is of translation happening in a cell in real time. How is this image different from the models we have made in this exercise? RNA Ribosomes A morphologists view of tramslation Polypeplide chaingarrow_forwardThe redundancy of the genetic code means that some amino acids arespecified by more than one codon. For example, the amino acid leucine is specified by six different codons. Within a genome, synonymous codons are not present in equal numbers; some synonymous codons appear much more frequently than others, and the preferred codons differ among species. For example, in one species, the codon UUA might be used most often to specify leucine, whereas in another species, the codon CUU might be used most often. Speculate on a reason for this bias in codon usage and why the preferred codons are not the same in all organisms.arrow_forwardA codon for leucine is UUA. A mutation causing a single-base substitution in a gene can change this codon in the transcribed mRNA into GUA (valine), AUA (isoleucine), CUA (leucine), UGA (stop), UAA (stop), UCA (serine), UUG (leucine), UUC (phenylalanine), or UUU (phenylalanine). According to the neutral theory of evolution, which of these mutations would you expect to be the most likely to be found within a natural population? Explain.arrow_forward
- As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′arrow_forwardYeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes to change its anticodon to 5'-GUU. a) What codon did the tRNA originally decode? Name the amino acid. b) What codon does the mutated tRNA decode? Name the amino acid.arrow_forwardConsider the following tRNAs, where the numbered forms represent the amino acids associated with them, answer briefly: PICTURE Question 1: The numbering indicates the order in which these tRNAs are recruited to the A site of the ribosome. Write the sequence of the mRNA being translated in the 5' - 3' direction Question 2: What is the amino acid sequence of the produced polypeptide? Question 3: Researchers discover that a mutation is in the anticodon of the gene encoding the proline tRNA of an individual. The anticodon sequence is normally 3' GGA 5', but in this individual the anticodon sequence is 3' GGG 5'. It appears that this individual suffers no adverse consequences. How can this be? (2 response items)arrow_forward
- During planetary exploration a new life form is discovered which has a DNA genome containing 6 different bases rather than the familiar four. The life form contains proteins with 25 different amino acids. Codons on Earth comprise three nucleotides; assuming a non-overlapping genetic code that includes initiation and termination codons, how many nucleotides would you predict to constitute a codon in the new life form, assuming all codons to be the same length? Briefly explain your answer.arrow_forwardIn prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated, whereas (normal) methionine is incorporated in eukaryotes. The same codon (AUG) serves both. What prevents methionine from being inserted into the beginning and formylmethionine in the interior?arrow_forwardOn the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education