Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 7EQ
What are G bands? Discuss how G bands are useful in the analysis of chromosome structure.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is the average length of linker DNA?
The axial ratio is a term used to describe a rod-shaped molecule using the ratio of its length to its diameter. Given that the
standard conformation of DNA in a physiological solution has a diameter of 2.37 nm, what is the axial ratio of the longest
chromosome of Drosophila melanogaster DNA, which is 21000 µm long? Please record your answer in scientific notation.
axial ratio:
x10
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro.
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction.
W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’
X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’
Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’
Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’
(b) What is branch migration?
(c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes?
(d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.
Chapter 8 Solutions
Genetics: Analysis and Principles
Ch. 8.1 - 1. A chromosome that is metacentric has its...Ch. 8.1 - Staining eukaryotic chromosomes is useful because...Ch. 8.2 - Prob. 1COMQCh. 8.3 - Which of the following statements is correct? a....Ch. 8.3 - Prob. 2COMQCh. 8.4 - 1. A paracentric inversion
a. includes the...Ch. 8.4 - Due to crossing over within an inversion loop, a...Ch. 8.4 - 3. A mechanism that may cause a translocation is...Ch. 8.5 - 1. Humans have 23 chromosomes per set. A person...Ch. 8.6 - Prob. 1COMQ
Ch. 8.6 - Prob. 2COMQCh. 8.7 - The term endopolyploidy refers to the phenomenon...Ch. 8.7 - 2. In agriculture, an advantage of triploidy in...Ch. 8.8 - Prob. 1COMQCh. 8.8 - The somatic cells of an allotetraploid contain a....Ch. 8 - 1. Which changes in chromosome structure cause a...Ch. 8 - Prob. 2CONQCh. 8 - 3. How does a chromosomal duplication occur?
Ch. 8 - 4. What is a gene family? How are gene families...Ch. 8 - Prob. 5CONQCh. 8 - Two chromosomes have the following orders for...Ch. 8 - An inversion heterozygote has the following...Ch. 8 - Prob. 8CONQCh. 8 - Explain why inversions and reciprocal...Ch. 8 - 10. An individual has the following reciprocal...Ch. 8 - A phenotypically normal individual has the...Ch. 8 - 12. Two phenotypically normal parents produce a...Ch. 8 - With regard to the segregation of centromeres, why...Ch. 8 - Prob. 14CONQCh. 8 - Prob. 15CONQCh. 8 - 16. A phenotypically abnormal individual has a...Ch. 8 - 17. A diploid fruit fly has eight chromosomes. How...Ch. 8 - Prob. 18CONQCh. 8 - Prob. 19CONQCh. 8 - 20. Aneuploidy is typically detrimental, whereas...Ch. 8 - 21. Explain how aneuploidy, deletions, and...Ch. 8 - Prob. 22CONQCh. 8 - 23. A cytogeneticist has collected tissue samples...Ch. 8 - Prob. 24CONQCh. 8 - A zookeeper has collected a male and a female...Ch. 8 - Prob. 26CONQCh. 8 - 27. What is mosaicism? How is it produced?
Ch. 8 - 28. Explain how polytene chromosomes of Drosophila...Ch. 8 - 29. Describe some of the advantages of polyploid...Ch. 8 - 30. While conducting field studies on a chain of...Ch. 8 - Prob. 31CONQCh. 8 - Which of the following terms should not be used to...Ch. 8 - Prob. 33CONQCh. 8 - Prob. 34CONQCh. 8 - A triploid plant has 18 chromosomes (i.e., 6...Ch. 8 - Prob. 36CONQCh. 8 - Prob. 37CONQCh. 8 - 38. A woman who is heterozygous, Bb, has brown...Ch. 8 - 39. What is an allodiploid? What factor determines...Ch. 8 - Prob. 40CONQCh. 8 - 41. Table 8.1 shows that Turner syndrome occurs...Ch. 8 - 42. Male honeybees, which are haploid, produce...Ch. 8 - Prob. 1EQCh. 8 - Prob. 2EQCh. 8 - With regard to the analysis of chromosome...Ch. 8 - 4. Describe how colchicine can be used to alter...Ch. 8 - 5. Describe the steps you would take to produce a...Ch. 8 - Prob. 6EQCh. 8 - What are G bands? Discuss how G bands are useful...Ch. 8 - A female fruit fly has one normal X chromosome and...Ch. 8 - Prob. 2QSDCCh. 8 - Besides the ones mentioned in this textbook, look...Ch. 8 - Prob. 4QSDCCh. 8 - 5. Discuss the importance of gene families at the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A chromosome from a multicellular slime mold called purple oblex (Plasmodiophora oblexii) is 13% adenine (A), what is the percentage of guanine (G)?arrow_forwardA diploid human cell contains approximately 6.4 billion base pairs of DNA. Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’arrow_forward
- Explain the term heterochromatin ?arrow_forwardIdentify the chromosome rearrangement that occurred between the two homologous chromosomes shown on the left to give the chromosomes shown on the right. (The letters represent large regions of the chromsome.) A B с OOOO A B C deletion inversion deletion and insertion translocation D A B D A B CCDarrow_forwardWhat is the difference between a random compact DNA and a chromosome. I mean what makes it a chromosome specifically ?arrow_forward
- What is the specific base sequence found in human telomeres, and how does the base sequence contained in the telomeric regions of chromosomes differ from that found elsewhere in the chromosome? (Please indicate both the base sequence and the 5’/3’ polarity.)arrow_forward1 3 3' T?L|| ?|||?| II|I |A|||T|||CL |||| 4 5 "A. Denote the 5' and 3' ends of all of the DNA strands in the figure noting that you are already given the 3' end of one of the strands." "B. What are the identities of the 6 bases marked by question marks at locations 1-6 for each chromosome? Note this is prior to any mismatch repair processes. Denote the correct identities on the figure or list them here." "C. Mark on the figure the regions of the DNA that is considered heteroduplex DNA if the Holliday junctions were resolved in the locations that they are currently depicted." "D. Assume that the Holliday junctions resolve so that there is no crossing over (that is, there is no recombination). For the maternal chromosome list all of the possible base identities at the three positions after the cell repairs any mismatches. Do the same for the paternal chromosome."arrow_forward4b) What is the functional difference between heterochromatin and euchromatin? In other words, what can a cell do (or not do) with euchromatic DNA but not heterochromatic DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License