Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 23, Problem 1QSDC
What is a molecular marker? Give two examples. Discuss why it is generally easier to locate and map molecular markers rather than functional genes.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
What are selectable marker genes ? Explain the role of selectable marker gene ?
ISSR is generally a dominant STS DNA marker. Nonetheless, with validated experimental evidence (e.g. laboratory and population genetics data), the marker can be used in codominance marker genotyping. Briefly explain each case below:
a) Codominant marker targets specific locus and reveals allelic variations in that locus among DNA samples.
b) Dominant marker: primers can complement other repeat sequences or in multiple loci thereby non-specificity in sampled genomes.
STR markers:
are point mutations detectable by DNA sequencing
are variations in the number of repeats of very short DNA motifs (2-10 nucleotides)
□have high polymorphism
are mutations leading to proteins or blood groups that can be differentiated by antigenic testing from a blood sample
☐have low polymorphism
no correct answer
are changes of a few nucleotides leading to the absence or presence of a site recognized by a restriction enzyme
are variations in the number of repeats of medium-sized DNA motifs (10-100 nucleotides)
can be located in coding sequences
are located exclusively on autosomes
Chapter 23 Solutions
Genetics: Analysis and Principles
Ch. 23.1 - Prob. 1COMQCh. 23.2 - Prob. 1COMQCh. 23.3 - A molecular marker is a _____ found at a specific...Ch. 23.3 - 2. Which of the following is an example of a...Ch. 23.3 - To map the distance between molecular markers via...Ch. 23.4 - 1. What is a contig?
a. A fragment of DNA that...Ch. 23.4 - A vector that can carry a large fragment of...Ch. 23.4 - 3. Chromosomal walking is a method of _____ in...Ch. 23.5 - Prob. 1COMQCh. 23.5 - Prob. 2COMQ
Ch. 23.5 - 3. A prokaryotic genome is about 4 million bp in...Ch. 23.6 - Metagenomics is aimed at a. determining the...Ch. 23 - 1. A person with a rare genetic disease has a...Ch. 23 - For each of the following, decide if it could be...Ch. 23 - Which of the following statements about molecular...Ch. 23 - 1. Is each of the following a method used in...Ch. 23 - Prob. 2EQCh. 23 - Prob. 3EQCh. 23 - The cells from a persons malignant tumor were...Ch. 23 - 5. Figure 23.2 describes the technique of FISH....Ch. 23 - Explain how DNA probes with different fluorescence...Ch. 23 - 7. A researcher is interested in a gene found on...Ch. 23 - Prob. 8EQCh. 23 - Prob. 9EQCh. 23 - Prob. 10EQCh. 23 - Prob. 11EQCh. 23 - Prob. 12EQCh. 23 - In the Human Genome Project, researchers have...Ch. 23 - 14. Take a look at question 3 in More Genetic...Ch. 23 - 15. Place the following stages of a physical...Ch. 23 - 16. What is an STS? How are STSs generated...Ch. 23 - 17. Four cosmid clones, which we will call cosmids...Ch. 23 - A human gene, which we will call geneX, is located...Ch. 23 - 19. Describe how you would clone a gene by...Ch. 23 - 20. A bacterium has a genome size of 4.4 Mb. If a...Ch. 23 - 21. Discuss the advantages of next-generation...Ch. 23 - Prob. 22EQCh. 23 - Prob. 23EQCh. 23 - What is a molecular marker? Give two examples....Ch. 23 - Which goals of the Human Genome Project do you...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the difference between a recombinant protein and a native protein? Why is it that some amount of expressions of recombinant protein are toxic compared to the same amounts of native proteins?arrow_forwardWhat is selectable marker gene?arrow_forwardHow to calculate the recombination rate between the marker and the gene? For example, how to calculate the recombination rate between the D17S74 marker and the breast cancer gene?arrow_forward
- What is homologous recombination and where/when does it typically take place in an organism. Homologous recombination is also used experimentally during gene targeting. If you wanted to remove the function of the mouse gene fibroblast growth factor 4 (FGF4) using gene targeting by homologous recombination, what are the different aspects of a targeting vector you would need to make?arrow_forwardWhat is a recombinant vector? How is a recombinant vector constructed? Explain how X-Gal is used in a method of identifying recombinant vectors that contain segments of chromosomal DNA.arrow_forwardDNA polymorphisms can be used as DNA markers. Describe the differences between SNPs and STR polymorphisms. How can these markers be used for DNA-mapping studies?arrow_forward
- What is recombinant tissue plasminogen activator (rec-tPA)?arrow_forwardPinpointing a disease gene requires a combination of approaches. Mutations in the XIAP gene are known to cause a serious condition called X-linked lymphoproliferative disease (XLPD). In the case of XLPD, in which the blood contains too many lymphocytes (white blood cells of the immune system), crowding out the oxygen-carrying red blood cells and damaging the liver. When compairing the XIAP amino acid sequence of one affected patient to other human and animal standard RefSeq, the patient has an amino acid substitution at position 203, from cystenine (C) to tyrosing (Y). This evolutionary conservation suggests Group of answer choices that the standard RefSeq does not provide enough information to determine a possible cause of XIAP function. mutations in the XIAP gene and XLPD are not associated. that the mutation in the affected patient has no impact on XIAP function. that the mutation in the affected patient might alter XIAP function.arrow_forwardWhen the S.cerevisiae genome was sequenced and surveyed for possible genes, only about 40% of those genes had been previously identified in forward genetic screens. This left about 60% of predcited genes with no known function, leading some to dub the genes fun (function unknown) genes. a)As an approach to understanding the function of a certain fun gene, you wish to create a loss of function allele. How would you do this? b)You wish to know the physical location of the encoded protein product. How would you obtain such information?arrow_forward
- Using the information provided below, which of the individuals A and B have: i) Genotypic change ii) Phenotypic change iii) Genotypic and phenotypic change X is the partial CDNA sequence of the normal CFTR gene. Use this to determine which DNA sequence (A &B) is the DNA extracted from a patient with and without disease. X) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACA Met. A V IR Q F P WA V Q T W Y D S L GAI .. A) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACAGGTATGACTCTCTTGGAGCAATAAACAA Met. B) ATGGCGGTCACTCGGCAATTTCCCTGGGCTGTACAAACTTGGTATGACTCTCTTGGAGCAATAAACA Met. Since this is a complementary DNA (CDNA) The nucleotide "T" can be directly replaced with U to get the mRNA strand. Example: ATG is AUG, TCA is UCA etc Second letter G UAU UCU c Phe UCc UGU UUC U UUA UAC JTyr UGCCYS Ser UCA UCG UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu G. CUU CCU CCC Pro CAU CAC Hi. CAA CAGJ CGU CGC CUC CUA Leu CCA Arg CGA Gin CUG CCG CGG AUU ACU ACC ACA AUG Met ACG LAsn AGUser AAC AUC…arrow_forwardThe table below shows different types of mutations in different positions in four genes. Choose the letter (A to E), from the drop-down menu, that represents the most likely type of protein that will be produced from each of these mutated genes. A: completely normal protein B: functional protein with ONE amino acid different from normal C: non-functional protein with ONE amino acid different from normal D: non-functional protein with MANY amino acids different from normal E: no protein at all Answer Type of mutation Position of mutation in gene (A, B, C, D, or E) before the part of the gene that specifies the active site of the enzyme 2 base pair insertion Inonsense immediately before the stop codon in the part of the gene that specifies the active site of the enzyme silent 1 base pair insertion in an intronarrow_forwardList three rules for designing primers?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY