Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 21.5PS
Library Science. You have constructed DNA probes that you want to use to verify the quality of a genomic library and a cDNA library recently produced from a preparation of rat liver cells in your lab. Probe #1 comes from a gene that is expressed in brain cells, whereas probe #2 comes from a gene expressed in liver cells. How would you expect the frequency of clones hybridizing with each of the probes to compare when the two libraries are probed? Explain your answer.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
Please answer this asap. Thanks,
You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
Describe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).
Chapter 21 Solutions
Becker's World of the Cell (9th Edition)
Ch. 21 - Antibiotics such as ampicillin are inactivated by...Ch. 21 - By weight, spider silk is stronger than steel, so...Ch. 21 - What are the similarities and differences between...Ch. 21 - Prob. 21.3CCCh. 21 - Prob. 21.4CCCh. 21 - Prob. 21.1PSCh. 21 - Prob. 21.2PSCh. 21 - Prob. 21.3PSCh. 21 - Tay-Sachs Screening. In a certain community, a...Ch. 21 - Library Science. You have constructed DNA probes...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forward. Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).arrow_forward
- Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forwardCan you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?arrow_forward. You need to amplify a gene from a source DNA for cloning in any cloning vector, which enzymes will be used to accomplish the task? Discuss role of each enzyme used for cloning a gene in step wise order.arrow_forward
- Pick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.arrow_forwardCRISPR? What are its applications in genetic engineering and gene therapy?arrow_forwardThe structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the restriction enzyme sites at the ends of the human DNA insert. Hint: think about the compatibility of the ends generated by partial digestion of human DNA and complete digestion of the vector – will the original sites in the vector be regenerated or not, or it is impossible to predict?arrow_forward
- protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Yarrow_forwardIn DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forwarda. Given the following restriction map of a cloned 10 kb piece of DNA, what size fragments would you see after digesting this linear DNA fragment with each of the enzymes or combinations of enzymes listed: (1) EcoRI, (2) BamHI, (3) EcoRI + HindlII, (4) BamHI + Psl, and (5) EcoRI + BamHI. b. What fragments in the last three double digests would hybridize with a probe made from the 4 kb BamHI fragment? E HH E ++ + 1.5 0.6 1.0 1.2 B E + 2.1 1.9 1.7 kbarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License