Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 21.7PS
QUANTITATIVE Introns. To investigate the possible presence of introns in three newly discovered genes (X, Y, and Z), you perform an experiment in which the restriction enzyme HaeIII is used to cleave either the DNA of each gene or the cDNA made by copying its mRNA with reverse transcriptase. The resulting DNA fragments are separated by gel electrophoresis, and the presence of fragments in the gels is detected by hybridizing to a radioactive DNA probe made by copying the intact gene with DNA polymerase in the presence of radioactive substrates. The following results are obtained:
(a) What can you conclude about the number of introns present in gene X?
(b) What can you conclude about the number of introns present in gene Y?
(c) What can you conclude about the number of introns present in gene Z?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene)
and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil
you
appear blue.
IPTG &
X-Gal &
NO colonies
Amp
E. coli JM109
E. coli JM109
50 mM calcium
chloride-15% glycerol
lac
lac
lac
IPTG &
I Recovery
X-Gal
solution at -702C
PBSKS
White colonies
E. coli JM109
E. coli JM109
ampR
amp I
amp
lac
lac
Heat Shock
Non-transformed
42°C
E. coli JM109
E. coli JM109
amps
amps
lac
lac
IPTG &
X-Gal
lac I
Recovery
lac
PBSKS
BLUE colonies
PBSKS
ampRI
(amp
Transformed
IPTG &
X-Gal &
BLUE colonies
Amp
Hypotheses: Circle the correct answer
1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin.
a. Why?
_
2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B-
galactosidase enzyme.
a. Why?_
3. If…
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
Chapter 21 Solutions
Becker's World of the Cell (9th Edition)
Ch. 21 - Antibiotics such as ampicillin are inactivated by...Ch. 21 - By weight, spider silk is stronger than steel, so...Ch. 21 - What are the similarities and differences between...Ch. 21 - Prob. 21.3CCCh. 21 - Prob. 21.4CCCh. 21 - Prob. 21.1PSCh. 21 - Prob. 21.2PSCh. 21 - Prob. 21.3PSCh. 21 - Tay-Sachs Screening. In a certain community, a...Ch. 21 - Library Science. You have constructed DNA probes...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Tyr- The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). s' CH₂ DNA Base O 111110 H CH₂ Basearrow_forwardPlease answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forward
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardBackward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other helicases have been reported to move in the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why you would expect helicases to move in one direction or the other?arrow_forwardHow many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forward
- Cloning vectors for E Coli. For each of the following items, describe what it is explain the necessity for each in cloning plasmids that are used for the expression (production) of protein. what would happen if this element was omitted? The Multiple Cloning Site (MCS) Origin of replication – (AmpR) antibiotic resistance gene – T7 promoter - T7 termination site- lac I genearrow_forwardPrimer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forwardRestriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864arrow_forward
- transformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forwardYes or no? No explanation. rna polymerase are recruiting to start transcription but promoters are DNA sequence. Taq polymerase is enzyme and can synthesize dna at 72 degrees. dna reads 5 to 3 and polymerase reads template 3 to 5.arrow_forwardHi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license