Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 21.9PS
“Outfoxing” FoxP2. The FoxP2 gene encodes a regulatory transcription factor implicated in vocalization in mammals and speech in humans. For each of the following scenarios, explain what experiment(s) you would perform to obtain the relevant information.
- (a) Most human tissues produce a FoxP2 transcript of 6.5 kb.
- (b) DNA recovered from well-preserved fossils of Neanderthals and Denisovans, extinct members of the genus Homo, has the same amino acid sequence as modern Homo sapiens.
- (c) FoxP2 RNA is expressed in specific neurons in the cerebral hemispheres of the mouse brain.
- (d) Mice make ultrasonic vocalizations (squeaks) when they are under stress. Assuming you had a way to monitor ultrasonic squeaks, design an experiment that would test whether FoxP2 is necessary for stress-induced ultrasonic vocalization in mice. Assume that mice can survive sufficiently well without FoxP2 function in a laboratory setting to perform your experiments.
- (e) Human patients carrying a mutation in the FoxP2 gene show severe speech and language deficiencies. When the genomic DNA from exon 4 of FoxP2 of such patients is cut with the enzymes EcoRI, EcoRV, AvrII and HindIII, the resulting fragments differ in size from those produced from FoxP2 of normal humans.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Part I. Structure-Function Relationships in Genes
1. Consider the "two-line model" of a gene shown below - each line represents one
strand of a DNA double helix, and the transcription start site is indicated as +1. Use the
two-line models provided when answering the following questions.
3'
5'
+1
Assume that you know RNA polymerase will move to the right during transcription.
On the diagram above, do the following:
• Label "upstream" and "downstream" on this gene
• Label where you would find the promoter
min
I
• Draw a box where you would expect to find the TATA box
• Draw a third line below the model representing the RNA transcript (label the
ends!)
• Label one of the DNA strands as the template strand
3'
2. Now, let's try that again! This time assume that you know RNA polymerase will move
to the left during transcription. Repeat the same tasks as before on the diagram below:
5'
5'
3'
+1
I
I
5'
3'
Molecular Biology (Biol-L211)
Dr. Nole
Central Dogma Practice - Processes
The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is
represented by each item in the diagram and clearly address each of the following.
A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA.
B. Label each arrow to indicate which is processing, transcription, replication, and translation.
C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence.
D. Identify the specific location of the place where the start codon and stop codon function most directly.
E. Where does RNA polymerase bind to begin transcription?
F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where
are they found?
G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3',
5', C-terminus, and N-terminus.)
True or False. In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.
Chapter 21 Solutions
Becker's World of the Cell (9th Edition)
Ch. 21 - Antibiotics such as ampicillin are inactivated by...Ch. 21 - By weight, spider silk is stronger than steel, so...Ch. 21 - What are the similarities and differences between...Ch. 21 - Prob. 21.3CCCh. 21 - Prob. 21.4CCCh. 21 - Prob. 21.1PSCh. 21 - Prob. 21.2PSCh. 21 - Prob. 21.3PSCh. 21 - Tay-Sachs Screening. In a certain community, a...Ch. 21 - Library Science. You have constructed DNA probes...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardprotein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of Gene Y is necessary for Gene Ys function. a. Liver: Functional Gene Y; Brain: Functional Gene Y b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Yarrow_forward
- Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardYes or no only. rna seq can provide sequence and expression data do riboprobes synthesize bu in vitro transcription? does rna causes mutations and lose of function of specific genes?arrow_forward
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardFill in the blanks. In this schematic, [] represents a gene (DNA) that is transcribed and processed to form [], which are mRNA molecules. [] represents one protein produced from the gene. The molecule that will function as a transcription factor is [].arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- Analyzing mRNA Sequences 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Glutamic Acid-Glutamic Acid- COO 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Valine-Glutamic Acid-CO (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.arrow_forwardconstruct! Which of the four constructs (Construct 1-4) below could you use to make your own mouse knockout? For each one you did not choose, explain why you did not choose that construct. Part of DHCR7 gene structure is shown on top row in the schematic. (Antibiotic selection and negative selection genes have been abbreviated.) Gene DHCR7 Intron 1 Exon 2 Intron 2 Exon 3 Exon1 Construct #1 Construct #2 Intron1 Negative Sel. Intron1 |Antibio. Sel. Negative Sel. Intron2 Antibio. Sel Intron 2 Construct #3 Construct #4 Introni Antibio. Sel Negative Sel. Negative Sel. Antibio. Sel. Intron2 Intron1 Intron2arrow_forwardBIOLOGY ACTIVITY -Gene Mutations and Proteins Objective: To demonstrate how gene mutations affect the production of proteins? Procedure: 1. Use the following base sequence of one strand of an AATTGAACACATGCGCCC. imaginary DNA molecule: 2 Write the base sequence for an mRNA strand that would be transcribed from the given DNA sequence. Place your results in the table below. 3. Use your codon table provided below to determine the sequence of amino acids in the resulting protein fragment. Place your results in the table below. 4. If the fifth base in the original DNA strand were changed from G to C, how would this affect the resulting protein fragment? Write the new protein fragment in the table below. 5. If G were added to the original DNA strand after the third base, what would the resulting mRNA look like? How would this addition affect the protein? Show your results in the table below. Data: mRNA from Step 2 Protein Sequence from Step 3 Protein Sequence from Step 4 mRNA from Step 5…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY