Concept explainers
DNA Sequencing. You have isolated the DNA fragment shown below (which you actually analyzed in Problem 16-3, on page 464):
3′AGCGCTATAGCGCT5′
5′TCGCGATATCGCGA3′
As a training exercise for a young labmate, you provide her with this DNA and instruct her to perform a restriction digest. From knowledge of the specificity of the restriction enzyme used to produce the fragment, she knows the first four bases at the left end. She has prepared a single-stranded DNA primer of sequence 5′TCGC3′. You ask her to explain how she would determine the rest of the sequence using dye-labeled dideoxynucleotides, and you ask her to draw the gel pattern that would be observed, indicating the base sequence of the DNA in each band and the color pattern that would be detected by the camera in a DNA sequencing machine. What should her explanation contain, and what should her drawing look like?
Want to see the full answer?
Check out a sample textbook solutionChapter 21 Solutions
Becker's World of the Cell (9th Edition)
- please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardPlease answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forwardIn the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forward
- Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forwardYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forward
- please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardgene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardPrimer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forward
- This is DWA. You hope to clone an extinct animal species by taking the easy route - using museum bones or tissues. You extract the DNA and use PCR to amplify, then sequence all segments of the genome You are unsuccessful. Later you discover that the museum specimens have been treated with formaldehyde, which forms covalent bonds in DNA, where once there existed H-bonds. What step in your PCR reaction would be inhibited? g -S Knowing this, if a human was exposed to formaldehyde, what enzyme(s) of DNA replication in vivo would be prevented from doing their job?arrow_forwardTyr- The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). s' CH₂ DNA Base O 111110 H CH₂ Basearrow_forwardConsidering DNA sequencing by the Sanger method. It is correct to say that: * A)In the traditional method, radioactively “labeled” primers are used, allowing their visualization in autoradiography. B)In the automated method, a single reaction is performed containing the four “labeled” dideoxynucleotides, each with a different fluorophore. C)In both traditional and automated methods, the fragments are resolved and interpreted according to their ionization state. D)In the automated method, di-deoxynucleotides “labeled” with the same fluorophore are used, thus allowing their interpretation based on graphs of fluorescence emission. E)Sequencing reactions can use mRNA molecules, as long as they have a polyA tail.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning