The restriction map of the recombinant plasmid for cloning of genomic DNA that contains the entire gene associated with a newly identified genetic disorder in humans based on the information regarding digestion of the genomic DNA by Bam HI and Hind III as provided in the question. Introduction: The restriction enzymes cleave DNA between specific sequences. These sequences are specific for a restriction enzyme. The specificity of the restriction enzymes has enabled us to study and manipulate genetic content. This is because of the specificity of the restriction enzymes task of restriction mapping of DNA can be performed.

Question

Want to see the full answer?

Answer 1

Question

Chapter 21, Problem 21.3PS

Summary Introduction

To determine: The restriction map of the recombinant plasmid for cloning of genomic DNA that contains the entire gene associated with a newly identified genetic disorder in humans based on the information regarding digestion of the genomic DNA by Bam HI and Hind III as provided in the question.

Introduction: The restriction enzymes cleave DNA between specific sequences. These sequences are specific for a restriction enzyme. The specificity of the restriction enzymes has enabled us to study and manipulate genetic content. This is because of the specificity of the restriction enzymes task of restriction mapping of DNA can be performed.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…

You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.

please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.