Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 21.4PS
Tay-Sachs Screening. In a certain community, a mutant allele for Tay-Sachs disease (the gene encoding the enzyme hexosaminidase A) exists at a high frequency. This mutation removes a HindIII restriction site (H) in the gene. A probe is available for this region, as shown in Figure 21-33a. Two couples in this community are expecting children. Each couple has a prenatal DNA test to determine if their child will have Tay-Sachs. The results of a Southern blot using HindII digested DNA probed for the region are shown in Figure 21-33b. What advice would you give to each couple in terms of preparing for a child with Tay-Sachs?
(a) Gene structure and probe location
(b) Southern blot
Figure 21-33 Using Southern Blots to Analyze Patients for Tay-Sachs. See Problem 21-4.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
I'm a genetic engineering. I want to create a new GMO that benefit curren society. I want to extract the blood from horseshoe crab to the spinach leaves. I found one article that said spinach leaves can grow human tissue. So, I assume that I put the horseshoe crab blood to the spinach leaves can grow animal protein (coagulogen). Then, we use the coagulogen to produce medicine. Provide me detail steps on how to create this GMO.
True or False. Explain.
A) At no time during protein synthesis does an amino acid make direct
contact with the mRNA being translated.
B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
Chapter 21 Solutions
Becker's World of the Cell (9th Edition)
Ch. 21 - Antibiotics such as ampicillin are inactivated by...Ch. 21 - By weight, spider silk is stronger than steel, so...Ch. 21 - What are the similarities and differences between...Ch. 21 - Prob. 21.3CCCh. 21 - Prob. 21.4CCCh. 21 - Prob. 21.1PSCh. 21 - Prob. 21.2PSCh. 21 - Prob. 21.3PSCh. 21 - Tay-Sachs Screening. In a certain community, a...Ch. 21 - Library Science. You have constructed DNA probes...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forwardBroken operators. Consider a hypothetical mutation in OR2OR 2 that blocks both A repressor and Cro binding. How would this mutation affect the likelihood of bacteriophage entering the lytic phase?arrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forward
- Macmillan Learning across generations. Place the events in the order necessary for an epigenetic modification to be inherited in the next generation. $ 4 900 F4 Certain CpG methylation sites are not erased during gametogenesis or embryogenesis. DNA methyltransferase recognizes and binds CpG sites on DNA. A methyl group is added to the cytosine residue of the DNA sequence. DNA methyltransferase maintains the methylation pattern on both DNA strands. % Recent studies have found instances of transgenerational inheritance of epigenetic traits in humans (Relton et al., 2012 already possess their eggs at birth whereas males do not produce sperm until nuberty For enigenetic modifications to 5 F5 ^ Methylated CpG sites on one inherited DNA strand 6 Epigenetic silencing passed to offspring F6 MacBook Air Answer Bank & 7 F7 * 8 DII. F8 DD F9 F10 J F11 Uarrow_forwardtransformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forwardTrue or False? Eukaryotic genomes are organized into operons; each operon consists of a series of genes which code for enzymes involved in a metabolic pathway, under the transcriptional control of a single promoter sequence .arrow_forward
- draw the p21 promoter. Your drawing should include (1) the start site, (2) the TATA box and (3) the ERE/AP-1 binding sitearrow_forwardto only 23 rounds for a woman of age 20. That is a 6.5-fold greater number of cell divisions and proportionately greater opportunity for new point mutations. Yet, on average, 20-year-old men contribute only about twice as many new point mutations to their offspring as do women. How can you explain this discrepancy?arrow_forwardResearch cancer mutation. Provide the link to the research article that gives you your information. One good resource to use is PubMed. Then answer the following questions, in 3 paragraphs, 3-5 sentences each. 1. What kind of disease/cancer does this mutation cause? 2.What happens during transcription to cause this mutation? 3. Is this trait passed on to progeny? Can the progeny be a carrier or simply affected?arrow_forward
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.arrow_forwardMatch the following. Write correct answer in the form of 1a, 5b, etc. in the space provided. 1. Gene Replacement A. No active gene is present 2. Gene Knockout B. Only mutant gene is active 3. Gene Addition C. Both normal and mutant genes are activearrow_forwardMatch the term with its description. cAMP Allows lactose to enter the cell and product of the lacY gene A regulatory sequence between the promoter and the structural genes of the lac operon When glucose levels are high, intracellular levels of this molecule are low Binds to and inhibits the function of the lac repressor when lactose is presentarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY