gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene)and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wilyouappear blue.IPTG &X-Gal &NO coloniesAmpE. coli JM109E. coli JM10950 mM calciumchloride-15% glycerollaclaclacIPTG &I RecoveryX-Galsolution at -702CPBSKSWhite coloniesE. coli JM109E. coli JM109ampRamp IamplaclacHeat ShockNon-transformed42°CE. coli JM109E. coli JM109ampsampslaclacIPTG &X-Gallac IRecoverylacPBSKSBLUE coloniesPBSKSampRI(ampTransformedIPTG &X-Gal &BLUE coloniesAmpHypotheses: Circle the correct answer1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin.a. Why?_2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B-galactosidase enzyme.a. Why?_3. If pBSKS is transformed into JM109 cells, colonies in the presence of X-gal will be (white/blue).a. Why?_4. If PBSKS is not transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin.a. Why?5. If PBSKS is not transformed into JM109 cells colonies in media with IPTG (will/will not) induce the production the B-galactosidase enzyme.a.Why?_6. If pBSKS is not transformed into JM109 cells, colonies in the presence of X-gal will be (white/blue).a. Why?_

We are allowed to do only upto three subpart of a question. Please repost the undone question again.…

1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? 2. If pBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If PBSKS is transformed into JM109 cells, colonies in the presence of X-gal will be (white/blue). Why?

1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? 2. If pBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If PBSKS is transformed into JM109 cells, colonies in the presence of X-gal will be (white/blue). Why?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
Pstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.
In E. coli, Base excision repair (BER) handles non-bulky lesions (e.g., deamination, oxidation) and nucleotide excision repair (NER) handles bulky lesions (e.g., Py dimers). Is this statement true or false? O True False
A cytosine is deaminated. Describe the outcome of this deamination and explain in detail how E. coli repairs this mutation using base excision repair (BER). This repair should contain 5 steps and describe the function of all enzymes or structures.
b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.
. Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’ direction.
Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
Conjugation: Diagram the process of conjugation in bacterial cells (using F plasmid transfer):a. In you diagram, label the parts of both the donor and recipient cell, draw an arrow, then show the resulting cells and their resulting phenotypes. Label any other special features needed for this process.
. Seven E. coli mutants were isolated. The activity ofthe enzyme β-galactosidase produced by cells containing each mutation alone or in combination with othermutations was measured when the cells were grown inmedium with different carbon sources.Lactose +Glycerol Lactose GlucoseWild type 0 1000 10Mutant 1 0 10 10Mutant 2 0 10 10Mutant 3 0 0 0Mutant 4 0 0 0Mutant 5 1000 1000 10Mutant 6 1000 1000 10Mutant 7 0 1000 10F′ lac from mutant 0 1000 101/ mutant 3F′ lac from mutant 0 10 102/ mutant 3Mutants 3 + 7 0 1000 10Mutants 4 + 7 0 0 0Mutants 5 + 7 0 1000 10Mutants 6 + 7 1000 1000 10Assume that each of the seven mutations is one andonly one of the genetic lesions in the following list.Identify the type of alteration each mutation represents.a. superrepressorb. operator deletionc. nonsense (amber) suppressor tRNA gene (assumethat the suppressor tRNA is 100% efficient in suppressing amber mutations)d. defective CRP–cAMP binding sitee. nonsense (amber) mutation in the β-galactosidase genef.…
ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…
. Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).