The restriction map of phage DNA representing restriction site for the enzymes X and Y along with the information regarding the length of DNA between the sites. Introduction: The restriction enzymes cleave DNA between specific sequences. These sequences are specific for an restriction enzyme. The restriction enzyme that cleaves DNA from any of the side is called as exonuclease while the restriction enzymes cleaving the DNA from within are called as endonuclease. The specificity of the restriction enzymes has enabled us to study and manipulate genetic content.

Question

Want to see the full answer?

Answer 1

Question

Chapter 21, Problem 21.1PS

Summary Introduction

To determine: The restriction map of phage DNA representing restriction site for the enzymes X and Y along with the information regarding the length of DNA between the sites.

Introduction: The restriction enzymes cleave DNA between specific sequences. These sequences are specific for an restriction enzyme. The restriction enzyme that cleaves DNA from any of the side is called as exonuclease while the restriction enzymes cleaving the DNA from within are called as endonuclease. The specificity of the restriction enzymes has enabled us to study and manipulate genetic content.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Restriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864

Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’

Restriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…