Becker's World of the Cell (9th Edition)
9th Edition
ISBN: 9780321934925
Author: Jeff Hardin, Gregory Paul Bertoni
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21, Problem 21.2PS
Summary Introduction
To explain: The restriction endonucleases made by Escherichia coli like bacteria to be used in molecular biology carry mutations and also explain the effect of this mutation.
Introduction: The restriction enzymes cleave DNA between specific sequences. These sequences are specific for a restriction enzyme. Restriction enzymes cleaving the DNA from within are called as an endonuclease. The transfer of genetic material inside the nucleus is possible due to the discovery of plasmids and is used as a vector to transfer the genetic material and cause mutations.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please help me with this question.
As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.
Please answer this asap. Thanks,
You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completely
Cloning vectors for E Coli. For each of the following items, describe what it is explain the necessity for each in cloning plasmids that are used for the expression (production) of protein. what would happen if this element was omitted?
The Multiple Cloning Site (MCS)
Origin of replication –
(AmpR) antibiotic resistance gene –
T7 promoter -
T7 termination site-
lac I gene
Chapter 21 Solutions
Becker's World of the Cell (9th Edition)
Ch. 21 - Antibiotics such as ampicillin are inactivated by...Ch. 21 - By weight, spider silk is stronger than steel, so...Ch. 21 - What are the similarities and differences between...Ch. 21 - Prob. 21.3CCCh. 21 - Prob. 21.4CCCh. 21 - Prob. 21.1PSCh. 21 - Prob. 21.2PSCh. 21 - Prob. 21.3PSCh. 21 - Tay-Sachs Screening. In a certain community, a...Ch. 21 - Library Science. You have constructed DNA probes...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…arrow_forwardplease help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forward
- You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forwardPick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.arrow_forwardRestriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction enzymes (single and double-cut) resulted in the fragments below. Draw a restriction map of the plasmid using the data provided below A. PCHEM 1234. Shown below are the restriction fragments BamHI 52 kb Hind III 26, 12, 8, 6 kb BamHI and HindIII double digest 14, 12, 8, 6 kbarrow_forward
- Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forwardPCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |arrow_forwardCRISPR? What are its applications in genetic engineering and gene therapy?arrow_forward
- B. Restriction Mapping. Single and double digestion of plasmid pMCS326 were performed using the restriction enzymes Alulll and EcoRV. DNA fragments are shown in an electrophoretogram below. Construct a restriction map of plasmid pMCS326 for enzymes Alulll and EcoRV. 20 kb 11 kb 8 kb 6 kb kb 3 Alulll + Alull EcoRV ECORV | || Restriction Map:arrow_forwardIn the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forward. Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY