Restriction mapping of a plasmid: Digestion of a plasmid pCHEM1234 with the following restriction enzymes (single and double-cut) resulted in the fragments below. Draw a restriction map of the plasmid using the data provided below A. ÞCHEM 1234. Shown below are the restriction fragments BamHI 52 kb Hind III 26, 12, 8, 6 kb BamHI and HindIII double digest 14, 12, 8, 6 kb
Q: Under typical conditions, how many protons are pumped across the mitochondrial intermembrane for eac...
A: NADH is the electron carrier that transfers electrons to complex 1 in respiratory chain . In respons...
Q: Give the name of the enzyme in this reaction along with detailed
A: Coenzyme A is a coenzyme which plays important role in the synthesis and oxidation of fatty acids, a...
Q: Differentiate sweet molecules in Column A using the criteria in column B.
A: Given: column A has two components which differs at different aspects as given in column B.
Q: Directionality of Polynucleotide chains originates at the ____ end, and terminates at the _____ en...
A:
Q: A. Heteroglycans are polysaccharides with only one type of monosaccharide unit. Heparin is a heterog...
A: Polysaccharides that are comprised of same type of monosacharide units, then it is termed as homopol...
Q: An a strain of yeast that cannot switch mating type isisolated. What mutations might it carry that w...
A: Yeast is a kind of organism that lives Saccharomyces cerevisiae is a single-celled eukaryote that ma...
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins ...
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers produc...
Q: Practice 26: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino...
A: Transcription is the process of synthesis of mRNA from DNA. During the translation process, the mRNA...
Q: Concanavalin (ConA) is a 25.5KDa protein with pl of 4.7 and optical absorbance (A 0.1% 289) of 1.14....
A: Proteins are polymers of amino acids with specific molecular weight and pI (isoelectric point, pH at...
Q: Two peptide sequences are shown below. Peptide A: N-term – GDL – C-term Peptide B: N-term – GTL – C-...
A: A peptide is a short chain of amino acids that contains one or more amino acids. Peptide bonds conne...
Q: SDS-PAGE reagents that play a role in denaturing the protein sample include (Select all that applies...
A: Proteins are present in their globular structure till they don't get denatured by something extraord...
Q: Provide one important function of activated APC?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: lysozyme was purified through G50 beads. From your lab experience, you can determine that when going...
A: Chromatography is biochemical separation method for organic molecules or solutes of a compound so...
Q: Kappa- and Iota- carrageenans contain 3,6-anhydro-a-D-galactopyranosyl residues. True False
A: Carrageenans are a family of hydrocolloidsh used for thickening, stabilising, and gelling solutions ...
Q: How does a protein form?
A: Proteins are the heteropolymers of twenty standard amino acids attached together via peptide bonds. ...
Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state? (...
A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus Dip...
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...
A: There are twenty naturally occurring amino acids that form proteins in biological systems.
Q: Classify each protein as fibrous or globular. A. albumin B. myosin C. fibroin
A: Globular proteins are characterized by having globin like fold. Globin heme bonding protein with rou...
Q: Label all 5 the indicted regions in this coenzyme (labels like site of redox activity, etc)
A: Coenzyme are molecules which enhances or facilitates the action of specific enzyme. Enzymes are usu...
Q: Consider three groups of solutes: (i) steroid hormones, fatty acids,and other lipids; (ii) inorganic...
A: The function of cell membranes is to organize and protect cells. The outer plasma membrane of every ...
Q: Aspirin reduces inflammation and prevent platelet aggregation by inhibiting the formation of which o...
A: Aspirin is nonsteroidal anti-inflammatory drug (NSAID) used to treat pain and inflammation. Aspirin ...
Q: His + Asp +Arg will engage this specific interaction * A. Hydrogen Bonding B. Disulfide Bonds C. N...
A: Introduction: Proteins are building blocks of life and they are made up of carbon, hydrogen, oxygen...
Q: (a) A solution containing these five proteins was adjusted to pH 7.0 and then applied to a SIZE-EXCL...
A: Chromatography is a method of separation of specific compounds from the mixture of compounds. This c...
Q: Refer to graph D, the graph level off art point B because.* A D The enzyme is beginning to denature ...
A: Enzymes are proteins whose activity is affected by factors that disrupt protein structure, or affect...
Q: 3. The trp repressor is a homodimer with 107 amino acid residues per monomer. The content of proton ...
A: As content of proton dissociable group presented in table, here we can count the charge status of di...
Q: Which of the following is INCORRECTLY paired? O Isoelectric focusing : Charge O Gel filtration chrom...
A: 1. Isoelectric focusing IEF is an electrophoretic method for separating proteins based on their isoe...
Q: Which of the following is NOT a unit of concentration? All of these options are units of conce...
A: The specific activity is the activity of the enzyme present per milligram of the total enzyme.
Q: What are the types of genes and their functions ?
A: Introduction: Gene is a basic unit of hereditary information and it determines the inherited charact...
Q: Write a conclusion about Qualitative Analysis of Amino Acids and Proteins You can use this as you...
A: Amino acids are the building blocks of the protein. Several quantitative and qualitative tests are u...
Q: What are the three groups of lipids and how do they differ?
A: Lipids are organic molecules that are generally insoluble in polar solvents such as water. lipids ar...
Q: Based on the figure and the explanation in the textbook, what are the random chances that the di-sul...
A: Denaturation is the process by which proteins lose their native conformation. Ribonuclease A has 124...
Q: 1. The overall charge of this protein at pH 7 is Drop-down answer choices are [positive, negative, o...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: Answer choices are provided below for drop-down questions. 1. The overall charge of this protein at...
A: Since you have asked multiple questions and haven't specified which has to be answered. Therefore, a...
Q: What is the process and principle behind isoelectric precipitation?
A: Isoelectric precipitation is a type of isoelectric precipitation that occurs when: The pH of a solut...
Q: Y,G,I,F,L,Y what is the biochemical propities of this residues.
A: - Tyrosine is a non-essential amino acid that the body produces from phenylalanine. - Tyrosine is an...
Q: Which of the following cause and effect relationships below is incorrect? higher ligand bindi...
A: Which of the following cause and effect relationships below is incorrect? higher ligand binding: in...
Q: 1.Classify each protein as fibrous or globular. A. hemoglobin B. keratin C. myoglobin
A: Proteins are classified into two categories, on basis of shape and solubility. 1. FIBROUS PROTEINS...
Q: Propose a reasonable pathway to degrade the following amino acid to core metabolic intermediates. Me...
A: In the given amino acid structure, there is additional amino group in sidechain and structure is sim...
Q: Identifies the roles of ventilation and PCO₂ in acid/base balance . Answer ASAP .
A: Acid is present in body in stomach.Acid and base balence in body is important for human health.Acid ...
Q: state the form in which the energy is present in the carbonhydrate eaten by the ox
A: Carbohydrates, abbreviated as carbs, are sugar molecules. Carbohydrates are one of three major nutri...
Q: Which of the following contain a correct first statement and an incorrect second statement? O Polyol...
A: Polyols have have several hydroxyl (-OH )groups in their structure. Hydroxyl groups make the polyols...
Q: Explained how metal ions help in enzyme action. Cite three vitamins that have antioxidant activities
A: The process of translation takes place in the cytoplasm which converts mRNA to protein/e...
Q: How can we use software to identify restriction-enzyme cutting sites in sequenced DNA ?
A: Restriction analysis is the process of identifying restriction mapping sites in DNA sequences by emp...
Q: 2. Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions ...
A: Hi! Thank you for the question. We are authorized to answer three subparts at a time, since you have...
Q: Kinesin-1 was the first member of the kinesin superfamily to be identified and therefore is perhaps ...
A: Kinesin are one of the mejor cytoplasmic motors responsible for long range transport in all eukaryot...
Q: (a) From the list below, select the amino acid(s) that might by more common in the extracellular dom...
A: Amino acids are the building blocks of proteins which is linked by peptide/amide bond to form polype...
Q: In generating CO2, how can the citric acid cycle discriminate between the carbons in citrate given t...
A: In the first phase of the cycle, acetyl CoA combines with oxaloacetate, a four-carbon acceptor molec...
Q: Arachidonic acids * A. Linoleic polyunsaturated omega-6 fatty acid is its starting material. B. Sp...
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain of ...
Q: Explain the importance of knowing the conformation/structure of proteins.
A: Proteins are biomolecules composed of amino acids. The amino acids are joined together through pepti...
Q: Please provide a chromatography technique to isolate the protein A from the mixture containing prote...
A: Protein A :- positively charged Protein B :- negatively charged For separation of charged molecules ...
Step by step
Solved in 2 steps with 1 images
- PCHEM4321. An agarose gel electrophoresis pattern of the plasmid PSPM4321 digestion (restriction) is shown below. Draw a restriction map of a plasmid with the appropriate restriction sites based on the data given below. Hindlll Hindll BamHI +BamHI Figure 1: 1% agarose gel electrophoresis of pCHEM4321 40 24 16 12 12 8 4 4 + |Kha Vu Danels Include: 8DX : Safehy Jor bromie tnto lab repart! Name Section date sheet MAPPING PRACTICE #1 Below is a restriction map for the plasmid PGEN 101 (total length = 20 Kb). Using this map as a guide, give the number of restriction fraqments along with their associated lengths that would result from digesting PGEN 101 with the restriction enzymes EcoRI, BamHI and a combination of ECORI and BamHI. BamHI 3.2 Kb 1.7 Kb EcoRI BamHI PGEN 101 8.7 Kb 5.5 Kb .9 Kb EcoRI ECORI DIGESTION PERFORMED SIZES OF FRAGMENTS OBTAINED 10.4 kb , 0.9kb, 8.7 Kb EcoRI 3.2 Kb, 16. 8kb BamHI EcoRI + BamHIYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.
- U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. PscI & GsuI ______________________________________________________________ ScaI, PdmI & BsaXI ______________________________________________________________ ScaI, SspI & EheI ______________________________________________________________Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3DI-Assume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.
- You utilised two plasmids in this practical, pOTC and pOTC-Δ. Plasmids are often represented using plasmid maps like the one below. This map shows the positions of recognition sites for a number of restriction enzymes Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzymes EcoRI and PvuII.Please answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyRestriction mapping sample question You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, Xbal, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Enzyme(s) used PstI ECORI HincII Band sizes observed (kb) 5.3, 2.7 5.4, 2.6 4.5, 3.5 6.7, 1.3 | 4.0 (high intensity band) 3.9, 3.7, 0.4 4.0, 3.5, 0.5 3.5, 2.6, 1.9 3.7, 3.6, 0.4, 0.3 3.7, 2.2, 1.7, 0.4 3.7, 3.0, 0.9, 0.4 3.9, 3.5, 0.4, 0.2 Smal Xbal ВатHI HinclI + Xbal HincII + ECORI XbaI + BamHI ECORI + BamHI Smal + BamHI HincII + BamHI Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be…
- Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 KbPrimer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…Genome for C. diphtheriae have about 2,500,000 nucleotides, 87% of them are coding. This ingle circular chromosome contains 2,389 genes from which 2,272 proteins are coded. It does not contain any plasmids. The genome contains Pathogenicity Islands (PAIs), which C. diphtheriae has 13. What is a PAI and what are their characteristics?