Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 3P
The human mitochondrial genome encodes only
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation:
a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________
b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion
c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
Metabolic syndrome is a genetic disorder with symptoms of hypertension, elevated blood cholesterol
concentrations, and lower-than-normal blood magnesium concentrations. This syndrome is caused by
a mutation in mitochondrial DNA (mtDNA) in which a thymine nucleotide is replaced by a cytosine
nucleotide.
Which of the following identifies the mutated mtDNA and the corresponding mRNA and tRNA produced in
a person with metabolic syndrome if the normal mtDNA triplet is TCG?
Select one:
a. Mutated mtDNA: CCG
mRNA: GGC
tRNA: GGC
b. Mutated mtDNA: TCG
mRNA: UGC
tRNA: ACG
c. Mutated mtDNA: CCG
mRNA: GGC
tRNA: CCG
d. Mutated mtDNA: TTG
mRNA: AAC
tRNA: UUC
Duchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene.
Chapter 17 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 17 - 17.1 Reciprocal crosses of experimental animals or...Ch. 17 - 17.2 How are some of the characteristics of the...Ch. 17 - 17.3 The human mitochondrial genome encodes...Ch. 17 - What is the evidence that transfer of DNA from the...Ch. 17 - Draw a graph depicting the relative amounts of...Ch. 17 - Prob. 6PCh. 17 - 17.7 What is the evidence that the ancient...Ch. 17 - 17.8 Outline the steps required for a gene...Ch. 17 - 17.9 Consider the phylogenetic tree presented in...Ch. 17 - You are a genetic counselor, and several members...
Ch. 17 - A mutation in Arabidopsis immutans results in the...Ch. 17 - What type or types of inheritance are consistent...Ch. 17 - You have isolated (1) a streptomycin-resistant...Ch. 17 - You have isolated two petite mutants, pet1 and...Ch. 17 - 17.15 Consider this human pedigree for a vision...Ch. 17 - A 50- year - old man has been diagnosed with MELAS...Ch. 17 - 17.17 The first person in a family to exhibit...Ch. 17 - Prob. 18PCh. 17 - 17.19 What is the most likely mode of inheritance...Ch. 17 - 17.20 In , the Russian Tsar Nicholaswas deposed,...Ch. 17 - 17.21 The dodo bird (Raphus cucullatus) lived on...Ch. 17 - Cytoplasmic male sterility (CMS) in plants has...Ch. 17 - 17.23 Wolves and coyotes can interbreed in...Ch. 17 - Prob. 24PCh. 17 - Prob. 25PCh. 17 - Most large protein complexes in mitochondria and...Ch. 17 - As described in this chapter, mothers will pass on...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 в в 11 E2 12 E4 Exon (E) Intron (1)arrow_forward
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forward1. Peroxisomes are organelles surrounded by a single membrane. Soluble proteins that reside within peroxisomes are imported post-translationally, and they often contain the C-terminal tripeptide SKL (serine-lysine-leucine). a) How would you confirm that a C-terminal SKL tripeptide is a peroxisomal targeting signal? b) If cells were engineered to produce a hybrid protein consisting of a mitochondrial matrix protein (including its signal sequence) followed by a C-terminal SKL signal, where in the cell would you expect the hybrid protein to be found? Explain your reasoning.arrow_forwardTransposable elements, “jumping genes”, were first described by Barbara McClintock in her Nobel prize winning studies with corn. The genome of every multicellular eukaryote that has been sequenced is composed of a large percentage of transposable elements (often 30% to 50%), but they are nearly absent from the genomes of eubacteria and archaea. What are these things and what do they do? Describe and draw the structural organization and mechanism for movement of transposons and retro- transposable elements. What effect do these elements have on the stability of genomes? can you help me answer the bolded question?arrow_forward
- Why do mitochondria need genes that encode rRNAs andtRNAs?arrow_forwardThree different chitin synthase genes control chitin synthesis in S. cerevisiae. Discuss what will happen to the budding yeast if a mutation occurs in each of the genes below: CHSI CHSII CHSIIIarrow_forwardThe sequences of DNA bases below represent parts of the genes responsible for the production of one type of protein, an enzyme, produced by Botana curus and Species X, Y, and Z Under each DNA sequence, write the complementary messenger RNA base sequences that each of these gene fragments would produce. Note: Unlike during DNA replication, in the production of messenger RNA, the DNA base “A” specifies the RNA base “U.”. Use the universal genetic code table provided (see Universal Code attachment) to translate the messenger RNA base sequences into sequences of amino acids in the protein produced by each species. Write the sequences of amino acids under the messenger RNA sequences.arrow_forward
- Consider the following tRNAs, where the numbered forms represent the amino acids associated with them, answer briefly: PICTURE Question 1: The numbering indicates the order in which these tRNAs are recruited to the A site of the ribosome. Write the sequence of the mRNA being translated in the 5' - 3' direction Question 2: What is the amino acid sequence of the produced polypeptide? Question 3: Researchers discover that a mutation is in the anticodon of the gene encoding the proline tRNA of an individual. The anticodon sequence is normally 3' GGA 5', but in this individual the anticodon sequence is 3' GGG 5'. It appears that this individual suffers no adverse consequences. How can this be? (2 response items)arrow_forwardHuman Chromosome 22 (48 × 106 nucleotide pairs in length) has about 700 protein-coding genes, which average 19,000 nucleotide pairs in length and contain an average of 5.4 exons, each of which averages 266 nucleotide pairs. What fraction of the average protein-coding gene is converted into mRNA? What fraction of the chromosome do these genes occupy?arrow_forwardIn the corn snake Pantherophis guttatus, there are several different color variants, including amelanistic snakes whose skin patterns display only red and yellow pigments. The cause of amelanism in these snakes was recently identified as the insertion of a transposable element into an intron in the OCA2 (oculocutaneous albinism) gene. How might the insertion of extra genetic material into an intron lead to a nonfunctional protein? H▾▾ B 2. = = 66 X² I A▾ X₂ Xarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license