Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 16, Problem 4TYK
Which of the following most closely represents Chargaff’s rule?
- a. A pairs with T and C pairs with G
- b. %A + %T = %C + %G
- c. %A + %G = %C + %T
- d. Strands in a DNA double helix are antiparallel.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following relations will be true for the percentage of bases in double-stranded DNA?
a. C + T = A + G
b. CA = TG
Assuming that a strand of DNA is not composed
of equal amounts of A, G, C, and T, which of the
following equations is appropriate when
considering DNA base composition?
O a. %A + %T = %G + %C
b. %A=%T=%G=%C
C. %A + %G=%T + %C
O d. %A = %G
e. %T = %U
What is true of this figure? (can be multiple answers)
a. the replication fork is asymmetrical
b. the DNA strands are anti-parallel
c. one strand runs 3’ to 5’
d. one strand runs 5’ to 3’
e. both strands have identical bases
Chapter 16 Solutions
Study Guide for Campbell Biology
Ch. 16 - Hershey and Chase devised an experiment using...Ch. 16 - Review the structure of DNA by labeling the...Ch. 16 - Using different colors for heavy (parental) and...Ch. 16 - Look back to Interactive Question 16.2 and label...Ch. 16 - In this diagram of bacterial DNA replication,...Ch. 16 - Draw the last Okazaki fragment being formed on the...Ch. 16 - List the successive levels of packing in a...Ch. 16 - Prob. 1SYKCh. 16 - Prob. 2SYKCh. 16 - One of the reasons most scientists thought...
Ch. 16 - Transformation involves a. the uptake of external...Ch. 16 - Prob. 3TYKCh. 16 - Which of the following most closely represents...Ch. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - In their classic experiment, Meselson and Stahl a....Ch. 16 - The joining of nucleotides in the polymerization...Ch. 16 - DNA polymerase is not able to begin copying a DNA...Ch. 16 - Prob. 10TYKCh. 16 - Prob. 11TYKCh. 16 - Prob. 12TYKCh. 16 - Which of the following is least related to the...Ch. 16 - Prob. 14TYKCh. 16 - Prob. 15TYKCh. 16 - Prob. 16TYKCh. 16 - Prob. 17TYKCh. 16 - Which of the following statements about telomeres...Ch. 16 - You are trying to test your hypothesis that DNA...Ch. 16 - Given the experimental procedure explained in...Ch. 16 - Prob. 21TYKCh. 16 - Biologists have learned from the technique of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule? a. A+T-G+C b. A+G=T+C A+C-G+T c. d. (A +T)/ (C+G) = 1.0 e. (A+G)/ (C+T)= 1.0 f. (A/C)=(G/T) g. (A/G)=(T/C) h. (A/T)=(G/C)arrow_forwardIn an analysis of the number of different bases in a DNA sample, which result would be consistent with the base-pairing rules? * A+T>G+C O AC+Tarrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward
- Use Chargaff's Rule to determine the percentage of base T in a sample of DNA that is 28% A and 22% C. O 22% T 28% T 44% 50% 56%arrow_forwardWhile studying the structure of a small gene that was sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains 20 As, 25 Gs, 30 Cs, and 22 Ts. How many of each base is found in the complete double-stranded molecule? A. A = 40, G = 50, C = 60, T = 44 B. A = 44, G = 60, C = 50, T = 40 C. A = 45, G = 45, C = 52, T = 52 D. A = 50, G = 47, C = 50, T = 47 E. A = 42, G = 55, C = 55, T = 42arrow_forwardEnzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides together. What would happen to DNA molecules treated with these enzymes? Group of answer choices A. All bases would be separated from the deoxyribose sugars B. The purines would be separated from the deoxyribose sugars C. The phosphodiester linkages between deoxyribose sugars would be broken D. The two strands of the double helix would separate E. The pyrimidines would be separated from the deoxyribose sugarsarrow_forward
- Which repeating sequence below would you expect to find on the end of the longest DNA strand of a chromsome (select one)? A. 5'-TTTTTT-3' B. 5'-TTAGGG-3' C. 5'-CCCTAA-3' D. 5'-AAAAAA-3' E. 5'-GGATCC-3'arrow_forwardThe following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all the mutant sequences that can result from spontaneous depurination in this stretch of DNA. b. Give all the mutant sequences that can result from spontaneous deamination in this stretch of DNA.arrow_forwardWhich of the following factors favors the formation of the Random DNA Coil? a Enthalpy b Base-Pairing c Phosphate group interactions d Stacking Energiesarrow_forward
- Indicate whether each of the following base-pairing situations (1) involves two DNA strands, (2) involves a DNA strand and an RNA strand, or (3) could involve either two DNA strands or a DNA strand and an RNA strand? a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C G a. A G T U C A b. A C T T G A c. A G U T C A d. C G C G C Garrow_forwardMatch the following type of DNA repair mechanism with the most appropriate definition. Nucleotide excision repair Homologous recombination Base excision repair Nonhomologous end joining A. Repairs thymine dimers by removing a section of the strand B. Corrects damaged bases by removing only the base C. Repairs double strand breaks by joining the ends D. Repairs double strand breaks by copying second chromosomearrow_forwardThe following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license