Study Guide for Campbell Biology
11th Edition
ISBN: 9780134443775
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece, Martha R. Taylor, Michael A. Pollock
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 16, Problem 10TYK
Summary Introduction
Introduction: DNA consists of genetic instructions in the form of gene sequences. Replication of DNA is semi-conservative. The parental strand acts as a template for the formation of a new daughter strand. This process is performed at the beginning of cell division so that each daughter cell inherits an identical DNA copy.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following is/are true regarding the enzyme primase?
a: primase functions during cellular DNA replication. b: without primase activity, DNA polymerase in our cell can NOT begin synthesizing new nucleotide chains. c: primase uses dNTP building blocks
d: primase is a polymerase enzyme
e: primase functions AFTER DNA helicase activity.
Ps: This has multiple answers. thank you.
List the stage of DNA replication when each of the following enzymes is active. a. helicase b. primase c. DNA polymerases d. ligase e. topoisomerase f. DNA gyrase
Which statement about Okazaki fragments is true?
Select one:
a. DNA polymerase doesn’t need a primer to build these fragments
b. They act as a primer that initiates DNA replication.
c. They correct errors made during earlier phases of DNA replication.
d. They are necessary because DNA polymerase can only build DNA in the 5’ to 3’ direction, so for one of the strands at each fork, the DNA polymerase can only buildaway from the fork.
e. They prevent the ends of chromosomes from shortening with every replication.
Chapter 16 Solutions
Study Guide for Campbell Biology
Ch. 16 - Hershey and Chase devised an experiment using...Ch. 16 - Review the structure of DNA by labeling the...Ch. 16 - Using different colors for heavy (parental) and...Ch. 16 - Look back to Interactive Question 16.2 and label...Ch. 16 - In this diagram of bacterial DNA replication,...Ch. 16 - Draw the last Okazaki fragment being formed on the...Ch. 16 - List the successive levels of packing in a...Ch. 16 - Prob. 1SYKCh. 16 - Prob. 2SYKCh. 16 - One of the reasons most scientists thought...
Ch. 16 - Transformation involves a. the uptake of external...Ch. 16 - Prob. 3TYKCh. 16 - Which of the following most closely represents...Ch. 16 - Prob. 5TYKCh. 16 - Prob. 6TYKCh. 16 - In their classic experiment, Meselson and Stahl a....Ch. 16 - The joining of nucleotides in the polymerization...Ch. 16 - DNA polymerase is not able to begin copying a DNA...Ch. 16 - Prob. 10TYKCh. 16 - Prob. 11TYKCh. 16 - Prob. 12TYKCh. 16 - Which of the following is least related to the...Ch. 16 - Prob. 14TYKCh. 16 - Prob. 15TYKCh. 16 - Prob. 16TYKCh. 16 - Prob. 17TYKCh. 16 - Which of the following statements about telomeres...Ch. 16 - You are trying to test your hypothesis that DNA...Ch. 16 - Given the experimental procedure explained in...Ch. 16 - Prob. 21TYKCh. 16 - Biologists have learned from the technique of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication? a. Both eukaryotic and prokaryotic DNA polymerases build off RNA primers made by primase. b. Eukaryotic DNA replication requires multiple replication forks, while prokaryotic replication uses a single origin to rapidly replicate the entire genome. c. DNA replication always occurs in the nucleus. d. Eukaryotic DNA replication involves more polymerases than prokaryotic replication.arrow_forwardIt is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA becauseotherwise which of the following events would result?a. The RNA would interfere with topoisomerasefunction.b. The RNA would be more likely to contain errorsbecause primase lacks a proofreading function.c. The β-clamp of the DNA pol II dimer would releasethe DNA and replication would stop.d. The RNA primers would be likely to hydrogen bondto each other, forming complex structures that mightinterfere with the proper formation of the DNA helixarrow_forwardDuring DNA replication, short RNA primers are made by the Primase. Why? a. To provide a 3'-OH so DNA polymerase can begin DNA synthesis. b. To recruit single stranded binding proteins to the correct location. c. To identify the termination sequence for DNA polymerase during DNA synthesis. d. To provide a 3'-OH so RNA polymerase can begin DNA synthesis. e. To identify the origin of replication to recruit the origin replication complex to the correct genomic location.arrow_forward
- Place the following steps of DNA replication and repair in the correct order by numbering them from 1 to 5. a. A template strand begins to be replicated. b. If the incorrect base is not identified and replaced, it remains as a point mutation in the DNA. c. DNA polymerase identifies and replaces most incorrect bases with the correct base, complementary to the base on the template strand. d. An incorrect base is added to the growing strand of DNA. e. Proteins identify and replace any incorrect bases missed by DNA polymerase.arrow_forwardWhich of the following is NOT true of DNA replication? a. Helicase uses ATP as an energy source. b. Primase uses ATP to build primers. c. Single-stranded binding proteins are enzymes that hold the strands open. d. Telomerase adds nucleotides to the original DNA template. e. Ligase uses a condensation reaction to make a single phosphodiester bond at each site of ligation..arrow_forwardMatch each enzyme name in the left column with the correct descriptive phrase in the right column. a. Topoisomerase II b. DNA ligase c. DNA polymerase y d. Reverse transcriptase i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA-RNA hybrid molecule e. DNA polymerase I f. DNA polymerase II iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA inter- mediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replicationarrow_forward
- Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…arrow_forwardWhich of the following statements is TRUE concerning the synthesis of the leading and lagging strands of DNA in prokaryotic cells? a. O b. The leading strand is synthesized by one polymerase III continuously, and the lagging strand is synthesized by several molecules of DNA polymerase III. d. The leading and lagging strands are synthesized at the same time by the one DNA polymerase I. O c. The leading and lagging strands are synthesized at the same time by the one DNA polymerase III. The leading strand is synthesized by one polymerase III, and the lagging strand is synthesized by DNA polymerase I.arrow_forwardWhich of the following is NOT TRUE about replication? A. Polynucleotides are made up of deoxynucleotide monophosphates but the substrates are deoxynucleotide triphosphates B. The mechanism of the reaction is nucleophilic addition C. In the formation of primers, nucleotides are added in any direction D. Both nucleotide triphosphates and deoxynucleotide triphosphates are substrates in replication E. Direction of synthesis is 5'23' and lengthens unidirectionally relative to the double strand.arrow_forward
- The function of DNA ligase is to: a. Catalyze formation of phosphodiester bonds between adjacent nucleotides b. Catalyze formation of hydrogen bonds between adjacent nucleotides c. Keep single strands of DNA apart during replication d. Facilitate base pairing between single stranded molecules in DNA e. Both a. and d. are correctarrow_forwardWhat was the significance of Meselson and Stahl’s experiments on DNA replication using the heavy isotope of Nitrogen? A. telomerase was identified as the molecule responsible for solving the end replication problem of eukaryotic chromosomes B. the existence of lagging strand synthesis was proven. C. the rate of DNA synthesis by DNA polymerase was measured D. the processivity of DNA polymerase was established E. the semi-conservative mode of DNA replication was confirmedarrow_forwardWhich of the following statements about the DNA replication is false? a. Synthesis of the new DNA strands is form 39 to 59 b.Synthesis of the new DNA strands is from 59 to 39 c. DNA Unwinds, primase adds RNA primer, DNA polymerases synthesize the new strand and remove the RNA primer d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite direction from the direction in which the replication for moves.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License